Genetic analysis of feline panleukopenia viruses from cats with gastroenteritis

Transcription

1 Journal of General Virology (2008), 89, DOI /vir / Genetic analysis of feline panleukopenia viruses from cats with gastroenteritis N. Decaro, 1 C. Desario, 1 A. Miccolupo, 2 M. Campolo, 1 A. Parisi, 2 V. Martella, 1 F. Amorisco, 1 M. S. Lucente, 1 A. Lavazza 3 and C. Buonavoglia 1 Correspondence N. Decaro n.decaro@veterinaria.uniba.it 1 Department of Public Health and Animal Sciences, Faculty of Veterinary Medicine, Strada per Casamassima km 3, Valenzano (BA), Italy 2 Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata, via Manfredonia 20, Foggia, Italy 3 Istituto Zooprofilattico Sperimentale di Lombardia ed Emilia Romagna, via A. Bianchi 9, Brescia, Italy Received 22 February 2008 Accepted 4 May 2008 Thirty-nine parvovirus strains contained in faecal samples collected in Italy (n534) and UK (n55) from cats with feline panleukopenia were characterized at the molecular level. All viruses were proven to be true feline panleukopenia virus (FPLV) strains by a minor groove binder probe assay, which is able to discriminate between FPLV and the closely related canine parvovirus type 2. By using sequence analysis of the VP2 gene, it was found that the FPLV strains detected in Italy and UK were highly related to each other, with a nucleotide identity of and % among Italian and British strains, respectively, whereas the similarities between all the sequences analysed were %. Eighty-eight variable positions were detected in the VP2 gene of the field and reference FPLV strains, most of which were singletons. Synonymous substitutions (n557) predominated over non-synonymous substitutions (n531), and the ratio between synonymous and non-synonymous substitutions (dn/ds) was 0.10, thus confirming that evolution of FPLV is driven by random genetic drift rather than by positive selection pressure. Some amino acid mutations in the VP2 protein affected sites that are thought to be responsible for antigenic and biological properties of the virus, but no clear patterns of segregation and genetic markers, were identified, confirming that FPLV is in evolutionary stasis. INTRODUCTION Canine and feline parvoviruses are small, non-enveloped, single-stranded DNA viruses that are responsible for haemorrhagic gastroenteritis and leukopenia, mainly in pups and kittens, with high mortality rates (Truyen, 2006). Carnivore parvoviruses (family Parvoviridae, genus Parvovirus), albeit DNA viruses, are very prone to genetic evolution, showing substitution rates similar to those of RNA viruses, with values of about substitutions per site per year. Their genetic evolution has been associated with the intrinsic variability related to the single-stranded DNA conformation, as well as to the positive selection pressure related to the host immunity (Shackelton et al., 2005). Feline panleukopenia virus (FPLV) was identified at the beginning of the 20th century (Verge & Christoforoni, 1928), maintaining a certain degree of genetic stability (Battilani et al., 2006a). However, molecular studies have not been carried out for several decades: therefore the The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are EU EU antigenic properties of the strains currently circulating are not well known. Also, the genetic and immunological relatedness between FPLV field strains and the vaccinal strains has not been evaluated, even though all the vaccines are prepared using the old FPLV strains. Several studies have demonstrated that some feline panleukopenia outbreaks in cats are caused not by classical FPLV strains but by the antigenic variants of canine parvovirus type 2 (CPV- 2) (Truyen, 2006). CPV-2, was first identified in the late 1970s, has likely arisen from FPLV after adaptation in an unknown wild-carnivore species (Truyen, 2006). Three antigenic variants of CPV-2 are currently known: namely CPV-2a, CPV-2b and CPV-2c, which have completely replaced the original type 2 that is still used in most commercial vaccines (Parrish et al., 1985; Buonavoglia et al., 2001). There are six or seven amino acid changes between FPLV and CPV-2 and an additional five or six amino acid changes between the variants CPV-2a/b/c and the original type 2. These few amino acid differences in the VP2 sequences account for important antigenic and biological / G 2008 SGM Printed in Great Britain

2 Genetic analysis of feline parvoviruses changes. For instance, in comparison to the original type 2, the antigenic variants are more aggressive and have regained the ability to replicate in vivo in the feline host (Carmichael, 2005; Truyen, 2006). In this study, genetic analysis of FPLV strains detected in the past 4 years was achieved by PCR amplification, sequence analysis and phylogeny carried out on the VP2 protein gene. METHODS Samples. A total of 39 faecal samples (Table 1) collected between 2001 and 2007 from cats with clinical signs of feline panleukopenia and confirmed to be parvovirus positive by a TaqMan PCR assay able to detect CPV and FPLV (Decaro et al., 2005c) were analysed. Thirtyfour samples were collected in Italy and an additional five samples were sent from veterinary clinics or laboratories in the UK. The FPLV strains contained in vaccines Felocell CVR (Pfizer) and Purevax RCP (Merial) were also analysed. Table 1. Summary of data of Italian and British FPLV strains analysed in this study Real-time PCR titres are presented as DNA copy numbers faeces mg 21 (field strains) or vaccine suspension (vaccine strains) ml 21. NA, Not applicable. Name Origin Year Real-time PCR titre GenBank accession no. Purevax Merial vaccine NA EU Felocell Pfizer vaccine NA EU /01 Italy EU /02 Italy EU /02 Italy EU /03 Italy EU /03 Italy EU /03 Italy EU /04-1 Italy EU /04-2 Italy EU /04-3 Italy EU /04-5 Italy EU /04 Italy EU /04-2 Italy EU /05 Italy EU /05 Italy EU /06 Italy EU /06-G1 Italy EU /06-G2 Italy EU /06-G3 Italy EU /06-G4 Italy EU /06-G5 Italy EU /06-G6 Italy EU /06-G7 Italy EU /06-G8 Italy EU /06-G10 Italy EU /06-G11 Italy EU /06-G12 Italy EU /06-G14 Italy EU /06-G16 Italy EU /06-G17 Italy EU /06-G18 Italy EU /06-G19 Italy EU /06-10 UK EU /06-11 UK EU /06 Italy EU /07-1 UK EU /07-2 UK EU /07 Italy EU /07 UK EU /07 Italy EU

3 N. Decaro and others Real-time PCR assay for discrimination between CPV and FPLV. DNA was prepared from faecal samples and vaccines by boiling the faecal or viral suspensions and subsequent chilling on ice, as reported previously (Decaro et al., 2006). DNA extracts were subjected to a minor groove binder (MGB) probe assay for rapid discrimination between true FPLV strains and the antigenic variants of CPV-2 (Decaro et al., 2008). The assay was carried out in a 25 ml reaction containing 10 ml DNA, 12.5 ml IQ Supermix (Bio-Rad), 900 nm primers FPV/CPV-For and FPV/CPV-Rev and 200 nm probes FPV-Pb and CPV-Pb (Table 2). Absolute quantification of the parvovirus DNA loads was obtained by means of standard curves constructed by using 10-fold dilutions of known amounts of FPLV or CPV field samples (Decaro et al., 2008). The thermal protocol was done as follows: activation of itaq DNA polymerase at 95 uc for 10 min, 45 cycles of denaturation at 95 uc for 30 s and primer annealing extension at 60 uc for 1 min. All reactions were conducted in an i-cycler iq Real-Time Detection System (Bio-Rad) and the data were analysed with the appropriate software (version 3.0). Parvovirus strains were characterized as FPLV and CPV on the basis of the detected VIC and FAM signals, respectively. PCR amplification of the VP2 gene. DNA extracts were used in conventional PCR assays using the Takara LA Taq kit (Cambrex) and three different primer pairs that amplify overlapping fragments encompassing the entire VP2 gene sequence (Table 2). The amplification was achieved by means of 35 cycles of denaturation at 94 uc for 30 s, annealing at 50 or 55 uc for 30 s and polymerization at 72 uc for 1 min. After electrophoresis on a 1.5 % agarose gel and ethidium bromide staining, the PCR products were excised from the gel and purified by a commercial kit (QIAquick gel extraction kit; Qiagen). Sequence analysis and phylogeny. The purified products were sequenced in both directions by Genome Express and the obtained sequences were assembled and analysed using the BioEdit software package (Hall, 1999) and the NCBI s (htttp:// and EMBL s ( analysis tools. The VP2 sequences obtained were compared with the following reference FPLV and CPV sequences retrieved from GenBank (accession numbers are reported in parentheses): FPLV CU-4 (M38246), 193/70 (X55115), FPV-483 (D88286), PLI-IV (D88287), V142 (AB054225), V208 (AB054226), V211 (AB054227), Gercules (AY665655), GT-2 (DQ003301), ZF-5 (DQ099430), JF-3 (DQ099431), Tiger/PT06 (EF418568), Lion/PT06 (EF418569), XJ-1 (EF988660), ARG01 (EU018145), ARG02 (EU018144), ARG03 (EU018143), ARG04 (EU018142); CPV-2 CPV-b (M38245), CPV-2a CPV-15 (M24003), CPV-2b CPV-39 (M74849), CPV-2c 56/00 (not available). To evaluate the selection pressure driving FPLV evolution, the ratio of synonymous substitutions per non-synonymous site (ds) and to non-synonymous substitutions per synonymous site (dn) was estimated using the Datamonkey web interface ( a maximum-likelihood-based tool for the identification of sites prone to positive or negative selection. The phylogenetic relationships were evaluated by using MEGA3 (Kumar et al., 2004); pairwise genetic distances were calculated by using the Kimura s two-parameter model and phylogenetic trees were constructed by the neighbour-joining and maximum-parsimony methods. A bootstrap analysis with 1000 replicates was done to assess the confidence level of the branch pattern. The maximumparsimony method was also used to confirm the topology of the phylogeny. Nucleotide sequence accession numbers. The nucleotide sequences of the VP2 gene of the analysed FPLV strains have been deposited in GenBank under accession numbers listed in Table 1. RESULTS Identification of FPLV in the clinical samples All the field strains detected by the TaqMan assay yielded VIC fluorescence in the FPLV/CPV MGB probe assay, Table 2. Sequence, position and specificity of the oligonucleotides used in the study Test Primer/probe Sequence 5 3 Polarity Specificity Position* (nt) Amplicon size (bp) Conventional PCRD CPV2655-F CCAGATCATCCATCAACATCA + FPLV/CPV CPV3511-R TGAACATCATCTGGATCTGTACC Conventional PCRD CPV3381-F CCATGGAAACCAACCATACC + FPLV/CPV CPV4116-R AGTTAATTCCTGTTTTACCTCCAA Conventional PCRd 555for CAGGAAGATATCCAGAAGGA + FPLV/CPV rev GGTGCTAGTTGATATGTAATAAACA FPV/CPV MGB assay FPV/CPV-F ACAAGATAAAAGACGTGGTGTAACTCA- + FPLV/CPV AATGGGAAATACAGACTATAT FPV/CPV-R CAACCTCAGCTGGTCTCATAATAGT FPV-Pb VIC ATGGGAAATACAGACTATAT MGB + FPLV CPV-Pb FAM ATGGGAAATACAAACTATAT MGB + CPV *Oligonucleotide positions are referred to the genomic sequence of FPLV strain FPV-b (GenBank accession no. M24004) and CPV-2 strain CPV-b (GenBank accession no. M38245). DPresent study. dbuonavoglia et al. (2001). Decaro et al. (2008) Journal of General Virology 89

4 Genetic analysis of feline parvoviruses being characterized as true FPLV strains and containing DNA titres ranging from to copies faeces mg 21 (Table 1). Titres detected for vaccine strains Purevax and Felocell were and DNA copies vaccine suspension ml 21, respectively. PCR amplification of the VP2 gene The three overlapping fragments of the VP2 gene of the FPLV strains were successfully amplified from all the 42 samples, including 40 field strains and two FPLV vaccines. Sequence analysis The full-length sequences of the VP2 gene (1755 nt) of the strains analysed were obtained by assembling the nucleotide sequences of the different amplicons. Amino acid translation confirmed that the sequences encoded a VP2 protein of 584 aa. The sequences obtained were aligned with the FPLV strains detected in samples from Argentina (n54), USA (n51), Japan (n55), China (n54), Portugal (n52), Russia (n51) and Austria (n51). Eighty-eight variable positions were detected in the VP2 gene, 50 of which were singletons. At position 1167, the polymorphism involved two different bases with the change TAC in all sequences, but strain 198/01 had the change TAG. Considering all the nucleotide changes encountered in the VP2 sequences, synonymous substitutions predominated over non-synonymous substitutions. In fact, of the 88 nt changes, 57 were synonymous and 31 were non-synonymous. When only the phylogenetically informative changes were assigned for comparison, the proportion of non-synonymous substitutions increased, but still remained less than synonymous substitutions. To examine the evolutionary pressure determining genetic variation in the VP2 gene of FPLV, the dn/ds ratio was calculated and this value was estimated as The single likelihood ancestor counting (SLAC) method did not detect any positively selected site, whereas nine sites subject to negative pressure selection were identified at codons 16, 233, 277, 291, 347, 389, 431, 524 and 534. By sequence analysis, the FPLV strains detected in samples from Italy and UK were found to be highly related to each other, with a nucleotide identity of and % among Italian and British strains, respectively, whereas the similarities between all the sequences analysed were %. A 100 % nucleotide identity was found between the following Italian FPLVs: 189/03 and 143/04, 134/04-5 and 228/06, 189/03 and 143/04, 46/06-G6, 42/06-G14 and 22/06, 498/07 and 443/07, 134/04-2, 42/06-G7 and 42/06-G17. The Italian strains had the lowest degree of identity in comparison to the Argentinean isolates ( %), whereas the strains most highly related were the Italian 134/04-2, 22/06, 42/06- G1, 42/06-G6, 42/06-G7, 42/06-G14, 42/06-G17 and the Portuguese Tiger/PT06 and Lion/PT96, the Italian 41/02, 189/03, 300/03, 143/04 and the Russian Gercules, the Italian 42/06-G3 and the Chinese JF-3, the Italian 189/03, 143/04 and the Chinese XJ-1. Also, the five British strains had a low genetic relatedness in comparison with the Argentinean isolates ( % nucleotide identity), but the highest similarity (100 %) was found between FPLV 490/07 and the vaccine strain Felocell. At the peptide level, several amino acid changes were found in the two regions forming the 22 Å (2.2 nm) long spike of the capsid surface on the threefold axis accumulating most residues that discriminate between FPLV and CPV (Horiuchi et al., 1998). Three changes were detected in region 1 comprising aa ; in this region, all Italian and four of five British strains displayed the mutation I101T, which differentiates the CPV variants from the original type 2. Such a mutation is shared by all recent FPLVs, including that contained in the vaccine strain Felocell. An additional nine changes were identified in region 2 (aa ), but no common pattern was found in this region, as each change was displayed by a single strain. Most residues discriminating between FPLV and CPV-2 were conserved, including 80-K, 93-K, 103-V, 323- D, 564-N and 568-A. However, four of five British strains and the two vaccinal strains displayed the change VAI at residue 232. Such a mutation, which has been considered typical of CPV-2, is also shared by FPLVs samples from Argentina, Japan and China (Table 3). Noteworthy singleton mutations were observed at residues 297 and 440 in the Italian strains 134/04-1 and 42/06-G5, respectively. Another change, R377K, was detected in the British strain 50/07-1. The two FPLV vaccine viruses were found to be genetically related to the old FPLVs (CU-4 and 193/70) and differed from each other only at residue 101, where strain Purevax retained I at this residue similar to the old FPLV isolates, in contrast to Felocell that shares a T residue similar to the recent CPV and FPLV strains. Phylogeny Phylogenetic analysis using the neighbour-joining method showed that FPLVs do not segregate on a clear temporal or geographical basis (Fig. 1). Two different clusters were formed by the VP2 nucleotide sequences analysed. The first cluster included only Italian strains and two Portuguese isolates from captive wild felids, but most viruses formed two groups into a larger cluster. Other Italian FPLVs segregated with Asian isolates into one of these groups, whereas the second group of the large cluster was formed by the remaining Italian and British strains along with vaccine viruses Purevax and Felocell, field strains from Argentina and old isolates (CU-4 and PLI-IV). The British strains 50/07-2 and 490/07 were tightly intermingled with vaccine and old FPLV strains, whereas another strain from the UK (50/07-1) was an outlier between the two main clusters. Two Italian FPLVs, 41/02 and 300/03, clustered together with the Russian isolate Gercules

5 2294 Journal of General Virology 89 Table 3. Non-synonymous substitutions detected in the VP2 gene sequences of FPLV strains -, Indicate identical nt and amino acid. Amino acid residue Nucleotide position CU-4 CCT P GCT A GGT G GCA A GCT A ATT I TTT F ATT N GAT D CAA Q GAA E AGA R ACA T GTA V CAT H CTA L 193/ FPV ACT T PLI-IV ACT T ATA I V ACT T V ACT T V ACT T Gercules ACT T GT AGT S - - GTT V ATA I TAT Y - - ZF ACT T - - AGT S AAT N JF TCA S - - ACT T Tiger/PT ACT T Lion/PT ACT T XJ ACT T ARG TCA S - - ACT T ATA I ARG TCA S - - ACT T ATA I ARG TCA S - - ACT T CTT L ATA I ATA I ARG TCA S - - ACT T ATA I Purevax ATA I Felocell ACT T ATA I / ACT T / ACT T / ACT T / ACT T / ACT T / ACT T / ACT T AAA K / ACT T / ACT T / ACT T / ACT T / ACT T / ACT T / ACT T ACT T / ACT T /06-G ACT T /06-G ACT T ATA I 42/06-G TCA S - - ACT T /06-G ACT T /06-G5 TCT S ACT T /06-G ACT T /06-G ACT T /06-G ACT T /06-G ACT T /06-G TCA S - - ACT T /06-G12 TCT S ACT T /06-G ACT T /06-G ACT T CAC H GAC D /06-G ACT T /06-G ACT T ACT T /06-G ACT T / ACT T / ACT T ATA I / ACT T / ACT T ATA I / ATA I / ACT T / ACT T ATA I / ACT T N. Decaro and others

6 Table 3. cont. Amino acid residue Amino acid residue Nucleotide position CU-4 AAA K TCT S TTT F GTT V CAA Q TCT S CAA Q AGA R AGA R TGG W ACA T GAT D TCT S ATT I GTA V 193/ FPV PLI-IV CTA L V V CTA L V Gercules TAT Y GT ZF CCT P JF Tiger/PT Lion/PT XJ GCT A ARG ARG CCT P GTT V - - ARG CGA R ARG Purevax CTA L Felocell CTA L 198/ / / / / /03 AAC N / TTT F / / / / / / / / /06-G /06-G /06-G /06-G /06-G TCA S /06-G /06-G /06-G /06-G /06-G /06-G /06-G /06-G /06-G /06-G /06-G / GGG G / / / AAA K GAA E / AGC S GAA E CTA L 443/ / CTA L 498/ Genetic analysis of feline parvoviruses

7 N. Decaro and others Fig. 1. Neighbour-joining tree based on the full-length VP2 gene sequences (1755 nt) of feline and canine parvoviruses. GenBank accession numbers for the reference strains used for phylogenetic tree construction are listed in the text. Statistical support was provided by bootstrapping over 1000 replicates. Bar indicates the estimated numbers of nucleotide substitutions per site Journal of General Virology 89

8 Genetic analysis of feline parvoviruses DISCUSSION FPLV and CPV, albeit highly related at the genetic level, showed a completely different pattern of evolution. After its first emergence in the late 1970s, CPV has progressively evolved under partly positive selection, giving rise to antigenic variants that replaced the original type and possess different biological and antigenic properties (Horiuchi et al., 1998; Shackelton et al., 2005). The CPV variants can be shed in the faeces at much higher titres than the original CPV-2 (Carmichael, 1994; Decaro et al., 2005a, b), probably as a consequence of a further adaptation of the CPV variants to the canine host. There is also concern that the newer antigenic variants may cause a more severe disease than the original CPV-2 (Carmichael, 2005). These changes in the biological behaviour may be associated with the improved ability of CPV-2a and CPV-2b to bind to the transferrin receptor in comparison with the original type 2 (Hueffer & Parrish, 2003). In contrast, FPLV since its first identification in 1920 has not undergone significant changes in antigenic and biological properties. FPLV has evolved mainly by random genetic drift and maintained host-specificity. Analogous to RNA viruses, CPV evolution was partly driven by positive selection, leading to the emergence of new antigenic variants and expansion of the host range (Shackelton et al., 2005). In the present study, 39 parvovirus strains from cats were analysed, all being characterized as true FPLVs. Sequence and evolutionary analyses of the 34 Italian and five British FPLVs confirmed that FPLV is in evolutionary stasis and its variation is driven by random genetic drift. Although several mutations were detected in the FPLV VP2 sequences examined, accumulation of point mutations was not consistent with a clear temporal or geographical distribution. Non-synonymous substitutions were detected in most strains analysed, but no genetic marker has been identified in the recent strains in comparison with the old isolates, with the exception of the change I101T, which is also present in the CPV-2 variants, but not in the old CPV- 2. Important mutations were the S297F and T440S changes detected in the Italian strains 134/04-1 and 42/06-G5, respectively. While change at residue 297 is due to a second-base mutation, a first-base change is responsible for substitution T440S (Table 3). A different substitution (SAA) at position 297 (due to the first-base change T889G) has been recently described for the antigenic variants of CPV-2 currently circulating throughout the world (Truyen, 1999, 2006; Battilani et al., 2001; Nakamura et al., 2004; Wang et al., 2005; Chinchkar et al., 2006; Martella et al., 2004, 2005, 2006; Meers et al., 2007). Residue 297 is located in the antigenic region close to epitope B and substitutions at this position may be responsible for changes in antigenicity of CPV-2 variants (Truyen, 2006). Analogously, a change at position 440 (TAA) has been described for Italian, Indian, Korean and American CPV-2 isolates (Battilani et al., 2002; Chinchkar et al., 2006; Kang et al., 2008; Kapil et al., 2007) and for a clone from a mixed CPV-2 population detected in a domestic cat from Italy (Battilani et al., 2006b). As for the FPLV strains, that change is a consequence of a first-base mutation (A1318G). Both residues 297 and 440 are present in the GH loop region of the VP2 protein, where the greatest variability among parvoviruses has been observed (Battilani et al., 2002). Strain 40/07-1 showed the change R377K that was due to a first-base substitution. This change has been associated with the inability to bind erythrocytes in a non-haemaglutinating CPV mutant, as a consequence of the shortness of the 377-K side chain or different ph with respect to R (Barbis et al., 1992). The vaccine strains Purevax and Felocell were more closely related to old FPLV strains, with the exception of British strains 490/07 and 50/07-2, which displayed a and % nucleotide identity to vaccine viruses, respectively. The genetic identity between the field strain 490/07 and the vaccine virus Felocell suggests a possible isolation of the vaccine strain from a cat recently vaccinated. In fact, it is well known that modified-live parvoviruses contained in the vaccines are able to replicate in the intestinal mucosa of vaccinated animals and to be shed with the dog or cat faeces (Decaro et al., 2007; Patterson et al., 2007). In our case, the anamnesis of the cat shedding a Felocell-like FPLV strain was not known, thus preventing the unambiguous identification of strain 490/07 as vaccine virus. Recently, several FPLV outbreaks in cats regularly vaccinated have been reported (C. Buonavoglia, personal observation). Whether the lower genetic relatedness of recent strains may affect the real efficacy of the FPLV vaccines currently used should be assessed by means of cross-neutralization studies using vaccine and field strains, as recently carried out for the CPV variants (Cavalli et al., 2008) and for the divergent porcine parvovirus isolates (Zeeuw et al., 2007). ACKNOWLEDGEMENTS We thank undergraduate student Annarosa Caradonna for her excellent assistance with part of the experimental work. We are also grateful to Donato Narcisi, Carlo Armenise and Arturo Gentile for their continuous technical assistance. REFERENCES Barbis, D. P., Chang, S. F. & Parrish, C. R. (1992). Mutations adjacent to the dimple of the canine parvovirus capsid structure affect sialic acid binding. Virology 191, Battilani, M., Scagliarini, A., Tisato, E., Turilli, C., Jacoboni, I., Casadio, R. & Prosperi, S. (2001). Analysis of canine parvovirus sequences from wolves and dogs isolated in Italy. J Gen Virol 82, Battilani, M., Ciulli, S., Tisato, E. & Prosperi, S. (2002). Genetic analysis of canine parvovirus isolates (CPV-2) from dogs in Italy. Virus Res 83, Battilani, M., Bassani, M., Forti, D. & Morganti, L. (2006a). Analysis of the evolution of feline parvovirus (FPV). Vet Res Commun 30,

9 N. Decaro and others Battilani, M., Scagliarini, A., Ciulli, S., Morganti, L. & Prosperi, S. (2006b). High genetic diversity of the VP2 gene of a canine parvovirus strain detected in a domestic cat. Virology 352, Buonavoglia, C., Martella, V., Pratelli, A., Tempesta, M., Cavalli, A., Buonavoglia, D., Bozzo, G., Elia, G., Decaro, N. & Carmichael, L. E. (2001). Evidence for evolution of canine parvovirus type 2 in Italy. J Gen Virol 82, Carmichael, L. E. (1994). Canine parvovirus type-2. An evolving pathogen of dogs. Ann Vet Med 135, Carmichael, L. E. (2005). An annotated historical account of canine parvovirus. J Vet Med B Infect Dis Vet Public Health 52, Cavalli, A., Martella, V., Desario, C., Camero, M., Bellacicco, A. L., De Palo, P., Decaro, N., Elia, G. & Buonavoglia, C. (2008). Evaluation of the antigenic relationships among canine parvovirus type 2 variants. Clin Vaccine Immunol 15, Chinchkar, S. R., Mohana Subramanian, B., Hanumantha Rao, N., Rangarajan, P. N., Thiagarajan, D. & Srinivasan, V. A. (2006). Analysis of VP2 gene sequences of canine parvovirus isolates in India. Arch Virol 151, Decaro, N., Campolo, M., Desario, C., Elia, G., Martella, V., Lorusso, E. & Buonavoglia, C. (2005a). Maternally-derived antibodies in pups and protection from canine parvovirus infection. Biologicals 33, Decaro, N., Desario, C., Campolo, M., Elia, G., Martella, V., Ricci, D., Lorusso, E. & Buonavoglia, C. (2005b). Clinical and virological findings in pups naturally infected by canine parvovirus type 2 Glu- 426 mutant. J Vet Diagn Invest 17, Decaro, N., Elia, G., Martella, V., Desario, C., Campolo, M., Di Trani, L., Tarsitano, E., Tempesta, M. & Buonavoglia, C. (2005c). A real-time PCR assay for rapid detection and quantitation of canine parvovirus type 2 DNA in the feces of dogs. Vet Microbiol 105, Decaro, N., Elia, G., Desario, C., Roperto, S., Martella, V., Campolo, M., Lorusso, A., Cavalli, A. & Buonavoglia, C. (2006). A minor groove binder probe real-time PCR assay for discrimination between type 2- based vaccines and field strains of canine parvovirus. J Virol Methods 136, Decaro, N., Desario, C., Elia, G., Campolo, M., Lorusso, A., Mari, V., Martella, V. & Buonavoglia, C. (2007). Occurrence of severe gastroenteritis in pups after canine parvovirus vaccine administration: a clinical and laboratory diagnostic dilemma. Vaccine 25, Decaro, N., Desario, C., Lucente, M. S., Amorisco, F., Campolo, M., Elia, G., Cavalli, A., Martella, V. & Buonavoglia, C. (2008). Specific identification of feline panleukopenia virus and its rapid differentiation from canine parvoviruses using minor groove binder probes. J Virol Methods 147, Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41, Horiuchi, M., Yamaguchi, Y., Gojobori, T., Mochizuki, M., Nagasawa, H., Toyoda, Y., Ishiguro, N. & Shinagawa, M. (1998). Differences in the evolutionary pattern of feline panleukopenia virus and canine parvovirus. Virology 249, Hueffer, K. & Parrish, C. R. (2003). Parvovirus host range, cell tropism and evolution. Curr Opin Microbiol 6, Kang, B. K., Song, D. S., Lee, C. S., Jung, K. I., Park, S. J., Kim, E. M. & Park, B. K. (2008). Prevalence and genetic characterization of canine parvoviruses in Korea. Virus Genes 36, Kapil, S., Cooper, E., Lamm, C., Murray, B., Rezabek, G., Johnston, L., Campbell, G. & Johnson, B. (2007). Canine parvovirus types 2c and 2b circulating in North American dogs in 2006 and J Clin Microbiol 45, Kumar, S., Tamura, K. & Nei, M. (2004). MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5, Martella, V., Cavalli, A., Pratelli, A., Bozzo, G., Camero, M., Buonavoglia, D., Narcisi, D., Tempesta, M. & Buonavoglia, C. (2004). A canine parvovirus mutant is spreading in Italy. J Clin Microbiol 42, Martella, V., Decaro, N., Elia, G. & Buonavoglia, C. (2005). Surveillance activity for canine parvovirus in Italy. J Vet Med B Infect Dis Vet Public Health 52, Martella, V., Decaro, N. & Buonavoglia, C. (2006). Genetic and antigenic variation of CPV-2 and implication in antigenic/genetic characterization. Virus Genes 33, Meers, J., Kyaw-Tanner, M., Bensink, Z. & Zwijnenberg, R. (2007). Genetic analysis of canine parvovirus from dogs in Australia. Aust Vet J 85, Nakamura, M., Tohya, Y., Miyazawa, T., Mochizuki, M., Phung, H. T., Nguyen, N. H., Huynh, L. M., Nguyen, L. T., Nguyen, P. N. & other authors (2004). A novel antigenic variant of canine parvovirus from a Vietnamese dog. Arch Virol 149, Parrish, C. R., O Connell, P. H., Evermann, J. F. & Carmichael, L. E. (1985). Natural variation of canine parvovirus. Science 230, Patterson, E. V., Reese, M. J., Tucker, S. J., Dubovi, E. J., Crawford, P. C. & Levy, J. K. (2007). Effect of vaccination on parvovirus antigen testing in kittens. J Am Vet Med Assoc 230, Shackelton, L. A., Parrish, C. R., Truyen, U. & Holmes, E. C. (2005). High rate of viral evolution associated with the emergence of carnivore parvovirus. Proc Natl Acad Sci U S A 102, Truyen, U. (1999). Emergence and recent evolution of canine parvovirus. Vet Microbiol 69, Truyen, U. (2006). Evolution of canine parvovirus A need for new vaccines? Vet Microbiol 117, Verge, J. & Christoforoni, N. (1928). La gastroenterite infectieuse des chats; est-elle due à un virus filtrable? C R Seances Soc Biol Fil 99, 312 in French. Wang, H. C., Chen, W. D., Lin, S. L., Chan, J. P. & Wong, M. L. (2005). Phylogenetic analysis of canine parvovirus VP2 gene in Taiwan. Virus Genes 31, Zeeuw, E. J., Leinecker, N., Herwig, V., Selbitz, H. J. & Truyen, U. (2007). Study of the virulence and cross-neutralization capability of recent porcine parvovirus field isolates and vaccine viruses in experimentally infected pregnant gilts. J Gen Virol 88, Journal of General Virology 89