1,4,5-trisphophate-induced Ca 2+ store depletion 1

Transcription

1 JBC Papers in Press. Published on September 5, 2000 as Manuscript M Xu, Longo, Wintermantel, Jiang, Clark and DeLisle Calreticulin modulates capacitative Ca 2+ influx by controlling the extent of inositol 1,4,5-trisphophate-induced Ca 2+ store depletion 1 Running Title: Calreticulin levels and InsP 3 -induced Ca 2+ store depletion Wen Xu *, Frank J. Longo, Mary R. Wintermantel, Xueying Jiang *, Robert A. Clark ** and Sylvain DeLisle * * U.S. Veterans Administration Medical Center and Departments of Medicine and Physiology, University of Maryland, School of Medicine, Baltimore, MD Department of Anatomy, University of Iowa College of Medicine, Iowa City, IA **Department of Medicine, South Texas Veterans Health Care System and University of Texas Health Science Center, San Antonio, TX Correspondence to: Sylvain DeLisle M.D., C.M. Departments of Medicine and Physiology University of Maryland at Baltimore 3B-185 VA Medical Center, 10 N. Greene St. Baltimore MD Tel ext Fax sdelisle@umaryland.edu 1 Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

2 Summary Calreticulin (CRT) is a highly conserved Ca 2+ -binding protein that resides in the lumen of the endoplasmic reticulum (ER). We overexpressed CRT in Xenopus oocytes to determine how it could modulate inositol 1,4,5-trisphophate (InsP 3 )-induced Ca 2+ influx. Under conditions where it did not affect the spatially complex elevations in free cytosolic Ca 2+ concentration ([Ca 2+ ] i ) due to InsP 3 -induced Ca 2+ release, overexpressed CRT decreased by 46% the Ca 2+ -gated Cl - current due to Ca 2+ influx. Deletion mutants revealed that CRT requires its high-capacity Ca 2+ -binding domain to reduce the elevations of [Ca 2+ ] i due to Ca 2+ influx. This functional domain was also required for CRT to attenuate the InsP 3 -induced decline in the free Ca 2+ concentration within the ER lumen ([Ca 2+ ] ER ), as monitored with a cameleon indicator. Our data suggest that by buffering [Ca 2+ ] ER near resting levels, CRT may prevent InsP 3 from depleting the intracellular stores sufficiently to activate Ca 2+ influx. 2

3 Introduction Since it was first isolated a quarter of a century ago (1), the protein calreticulin (CRT) 2 has been identified in a great variety of cells, implying an essential biological activity (2). Although CRT may be critical for cardiac development (3), to date, the nature of CRT s cellular function remains poorly understood. CRT binds to steroid receptors (4,5) and to integrins (6,7) and thus could modulate gene transcription (8,9) or cellular adhesion (2,10-12). To reach these targets however, CRT would need to be present both in the nucleus and the cytosol. Although CRT has been reported in these cellular compartments ((2,10), but see also (13)), the bulk of the protein clearly resides elsewhere i.e. inside the endoplasmic reticulum (ER). Within the ER lumen, CRT may assist in the folding and assembly of glycoproteins (14-17). ER CRT may also act as a repository of readily releasable Ca 2+, with each mole of CRT binding as many as moles of Ca 2+. Since Ca 2+ release from the ER is controlled mainly by the second messenger inositol 1,4,5- trisphophate (InsP 3 ), CRT emerges as a potential regulator of this ubiquitous signal transduction pathway. The InsP 3 -induced Ca 2+ signal has two main components, the release of Ca 2+ from the intracellular stores (InsP 3 -induced Ca 2+ release, or IICR) and the influx of Ca 2+ across the plasma membrane (InsP 3 -induced Ca 2+ influx, or IICI). IICR starts when InsP 3 binds to its intracellular receptor (InsP 3 R), a ligand-gated Ca 2+ channel that traverses the lipid 3

4 membrane surrounding the ER. The resulting discharge of ER Ca 2+ into the cytosol is often spatially complex, with periodic focal release of Ca 2+ actively spreading to the rest of the cell through mechanisms that remain incompletely understood (18). IICI commonly follows IICR, thereby allowing cells to recharge their internal stores. Stimulation of Ca 2+ influx appears closely linked to the depletion of the intracellular Ca 2+ stores, a relationship known as capacitative Ca 2+ entry. We do not yet understand how Ca 2+ store depletion stimulates Ca 2+ influx. Store depletion could communicate with the plasma membrane through a diffusible messenger (19,20), through secretion-like vesicular docking (21,22), or through protein-protein interactions that may involve the InsP 3 R itself (23-25). Even though Ca 2+ storage was the first function ascribed to CRT (1), we do not yet know what role, if any, CRT plays in the regulation of the InsP 3 -induced Ca 2+ signal. While gene knock-out experiments indicate that CRT is not essential for IICR (11), overexpression of CRT has been associated with a decrease in the magnitude of IICI in mammalian cell lines (26-28). These results have prompted the hypothesis that CRT reduces capacitative Ca 2+ entry by buffering the free Ca 2+ concentration within the ER lumen ([Ca 2+ ] ER ) above the levels required to trigger capacitative Ca 2+ influx. In this work, our objective was to put this hypothesis to a rigorous test by directly measuring [Ca 2+ ] ER in a widely used model cell, the Xenopus oocyte. Our data indicate that CRT 4

5 requires its high-capacity Ca 2+ -binding domain both to attenuate the InsP 3 -induced decrease in [Ca 2+ ] ER and to reduce the elevations of [Ca 2+ ] i due to IICI. CRT s ability to buffer [Ca 2+ ] ER may thus be functionally relevant to the InsP 3 -induced Ca 2+ signal. 5

6 Experimental Procedures CRT and CRT deletion mutant expression vectors We inserted the CRT cdna cloned from the HL60 human leukemia cell line (29) between the PstI and SalI sites of the pmt3 plasmid vector (30). We used the polymerase chain reaction (PCR) to build CRT mutants lacking functional domains. To remove the C-domain (CRT- C), we amplified CRT s N and P domains (amino acids 2-315) and added a KDEL ER retrieval sequence at the C-terminus (primers 1 and 2). The PCR fragment was digested with MluI and EcoRI and inserted between those sites in a modified pmt3. For the construct lacking the P-domain (CRT- P), we amplified the N-domain (amino acids 2-197, primers 1 and 3) and the C-domain (amino acids , primers 4 and 5) separately. The PCR fragments were then respectively digested with MluI/ SpeI and with SpeI/ EcoRI and ligated between the Mlu1 and the EcoRI sites of pmt3. Primers sequence were as follows, from 5 to 3 : Primer #1: GTCACGCGTCTGCTATCCGTGCCGCTG; Primer #2: CGGAATTCTCAGAGTTCATCCTTGCCCAGCACGCCAAAGTTATC; Primer #3: CGTACTAGTTTCCAAGGAGCCGGAC; Primer #4: GTCACTAGTCTGGATCTCTGGCAAGTCAAGTCTGG; Primer #5: CGGAATTCTCATTCGAGTCTCACAGAGAC. cdna-directed protein expression and Western blotting We prepared stage V-VI 6

7 oocytes from albino Xenopus laevis and injected the DNA constructs into the nucleus as previously described (31,32). Oocyte microsome purification, protein solubilization, SDS-PAGE and transfer to nitrocellulose were as outlined in the past (33). For immunoblotting, we used a polyclonal antibody raised against the full-length recombinant HL60 CRT (29). We performed all our functional studies hours after plasmid injection, when CRT expression level was found to be maximal in preliminary experiments. Electrophysiology We assayed [Ca 2+ ] i by measuring Ca 2+ -activated Cl - currents with the two-electrode voltage clamp technique (31). This assay has been validated using Ca 2+ - sensitive electrodes (34-36) and fluorescent Ca 2+ indicators (31,37-41). We performed intracellular injections and calibrated the injection pipettes as we had done in the past (31). Bath solution contained in mm: 116 NaCl, 2.0 KCl, 1.8 CaCl 2, 1 MgCl 2, 5 HEPES, ph 7.4. In the experiments where Ca 2+ stores were to be irreversibly depleted, oocytes were incubated with 2 µm thapsigargin (Calbiochem Novabiochem, La Jolla CA) for 3 hours (42,43). Cells were then microinjected with 4 nmol of either EGTA (Sigma) or BAPTA (Molecular Probes, Eugene OR) to prevent [Ca 2+ ] i elevations from activating the Ca 2+ -activated Cl - currents. Cells were then put into a bath solution (in mm: either 70 MgCl 2 or 70 CaCl 2, 10 HEPES, ph 7.2) and the inward Ca 2+ current resulting from the 7

8 influx of extracellular Ca 2+ were directly measured with the two-electrode voltage clamp technique (43). To ensure that the individual cells studied electrophysiologically expressed the protein of interest, plasmid cdna coding for CRT or CRT mutants was co-injected with pmt3- sg25 (20:1 concentration ratio), a vector coding for an enhanced green fluorescent protein (GFP). We performed electrophysiology experiments on those live cells that showed the highest GFP fluorescence. Monitoring [Ca 2+ ] ER with fluorescence resonance energy transfer (FRET) We excised the yellow cameleon-3er or -4er (3er or 4er) cdnas (gifts from Dr. Roger Y. Tsien, Howard Hughes Medical Institute, University of California, San Diego, CA) from the pcdna vector and inserted them between the Not1 and EcoR1 sites of pmt3. The 3er/4er Ca 2+ indicators contain two mutated GFP yielding cyan (CFP) or yellow (YFP) fluorescence (44). The amino acids linking YFP to CFP includes the sequences for calmodulin (CaM) and for the M13 CaM-binding peptide. Upon Ca 2+ binding, CaM enfolds M13 thereby creating FRET between YFP and CFP. To enable measurements of the relatively high [Ca 2+ ] ER, 3er and 4er s CaM sequences were modified to lower their affinity for Ca 2+ (44). 3er and 4er also include sequences from CRT that allow their retrieval into the ER lumen. To measure FRET, we illuminated oocytes expressing 8

9 3er/4er (λ = 440 ± 15 nm, DeltaRam monochromator, Photon Technology International, Monmouth Junction, NJ, 455DCLP dichroic mirror) and recorded the emission intensity at two wavelengths, 485 and 535 nm, using separate photomultiplier tubes (520DCLP dichroic mirror, D485/40M and D5356/30M emission filters, Chroma Technology, Brattleboro, VT). If we could not calibrate 3er in vivo, we could nevertheless use the 535/485 fluorescence ratio to compare [Ca 2+ ] ER among cells submitted to identical illumination. In these experiments, the gains of the photomultiplier tubes were carefully matched and neutral black levels determined experimentally (45). Immunolocalization Oocyte cryosections (5 µm thick) were incubated for 30 min first with 1/200 to 1/500 dilutions of the anti-crt antibody, then with a FITC-conjugated anti-rabbit secondary antibody, and examined with a fluorescence microscope as described before (32). For ultrastructural studies, cryosections (10 µm thick) were fixed, incubated for 1 hr in anti-crt antibody and then overnight in anti-rabbit antibody conjugated to 5 nm gold particles (Janssen Life Sciences Products, Piscataway, NJ), and prepared for examination under in a Hitachi 7000 electron microscope (Hitachi Ltd., Tokyo) as previously described (32). 45 Ca 2+ uptake Oocytes injected either with pmt3 alone or with pmt3-crt were incubated in 45 Ca 2+ -containing solution (8 µci/ml). 45 Ca 2+ -related counts increased 9

10 gradually and reached a plateau at hours, indicating equilibration across the oocyte s Ca 2+ -binding compartments. After a 72 hour incubation period, chosen to ensure isotopic equilibrium, intact oocytes were washed 5 times in cold solution and individually transferred to scintillation vials for counting. Alternatively, the washed oocytes were combined, homogenized and their microsomes purified and recovered on filter paper prior to counting, as per our previously published methodology (33). Calcium imaging and confocal microscopy Oocytes were injected with either fluo 3 alone (250 µm), Ca 2+ orange alone (250 µm) or a mixture of fluo 3 (100 µm) and fura red (300 µm) (Molecular Probes). They were then stimulated with a 30 nl droplet of Ins(2,4,5)P 3 (10 µm) and the resulting fluorescence visualized on a confocal microscope as previously described (46). Ca 2+ wave amplitude, velocity, frequency as well as rates of rise/decrease in [Ca 2+ ] i at the wave fronts were determined as detailed before (32). To compare [Ca 2+ ] i between different cells using visible excitation wavelengths, we ratioed the simultaneously measured fluorescence signal from fluo 3 and fura red (45). The detailed validation of this technique in the oocyte has been previously published (32). Image analysis was performed using the NIH Image v.1.61 software ( 10

11 Results and Discussion Overexpression of CRT in Xenopus oocytes. On a Western blot of microsomal proteins from which we have previously purified CRT, the ER lumenal protein calsequestrin and the InsP 3 R (33,47), an anti-crt antibody (29) labeled a ~60 kda protein (Fig. 1, lanes 1). After injection with pmt3-crt, the density of this band increased significantly, indicating overexpression of CRT (Fig. 1, lane 2). Immunostaining revealed reticular fluorescence that increased from the vegetal to the animal pole of the cell in a pattern similar to that of control cells, but much brighter (Fig. 2). We observed a similar fluorescence pattern with overexpressed InsP 3 R (32). Under electron microscopy using a gold-labeled secondary antibody targeted at an anti-crt primary antibody, the gold particles were found in association with membranous cisternae most likely representing elements of the ER (Fig. 3). There was no label associated with mitochondria or with other organelles. Given CRT s ER retrieval sequences and lack of hydrophobic regions that can stretch across lipid bilayers, our data suggest that CRT is overexpressed within the ER lumen. CRT decreases the [Ca 2+ ] i elevations due to Ca 2+ influx. To investigate the effect of CRT overexpression on Ca 2+ influx, we microinjected either pmt3 or pmt3-crt in oocytes. We then stimulated the cells with a saturating concentration of InsP 3 (10 nl of 10-3 M solution, or a 10 µm average concentration) and assayed [Ca 2+ ] i by measuring Ca 2+ -gated 11

12 Cl - current with the two-electrode voltage-clamp technique. The Ca 2+ -gated Cl - current reflects [Ca 2+ ] i just beneath the plasma membrane (48,49), where it is most likely to be affected by Ca 2+ influx. The assay integrates the submembranous [Ca 2+ ] i changes across the entire surface of the plasma membrane thereby maximizing our ability to detect changes in the magnitude of Ca 2+ influx. In control cells, microinjection of InsP 3 (10-3 M in the pipette) causes a biphasic response: there is a short initial increase in [Ca 2+ ] i followed by a slow increase (Fig. 4A). The fast initial component of the response, which is not affected by the removal of extracellular Ca 2+, is due to the release of Ca 2+ from the intracellular stores (50,51). In contrast, the slow component of the response can be inhibited by decreasing the extracellular Ca 2+ concentration or by adding inorganic Ca 2+ channel blockers (Mn 2+, Ni 2+, La 3+ ) to the bath, and thus depends on Ca 2+ influx (50-52). While the magnitude of the Cl - currents due to IICR was similar to that of control cells (272 ± 28 na in CRT vs. 247 ± 23 na in controls, n = 31 pairs of cells), the Ca 2+ influxdependent Cl - current was reduced almost in half in cells overexpressing CRT (77 ± 15 na vs. 143 ± 19 na in controls, n = 31 matched pairs of cells, one of which is shown in Fig. 4, p <.001). These results, which are consistent with those obtained in mammalian cell lines (26,27), indicate that CRT reduces the rise in [Ca 2+ ] i due to Ca 2+ influx. Direct measurements of whole cell current due to Ca 2+ or Ba 2+ entry have indicated that the Ca 2+ -gated Cl - current assay has a high sensitivity for measuring the magnitude of Ca 2+ influx 12

13 (22,43). Thus, our results suggest that CRT overexpression reduces the rate at which extracellular Ca 2+ enters the cell. CRT attenuates the InsP 3 -induced decline in [Ca 2+ ] ER. In the context of capacitative Ca 2+ entry, CRT could reduce IICI by buffering [Ca 2+ ] ER to levels above those required to stimulate Ca 2+ influx. Because neither the precise value of [Ca 2+ ] ER nor the degree to which CRT contributes to the overall Ca 2+ -binding properties of the ER lumenal milieu is presently known, we could not confidently predict if/how altered CRT levels affect [Ca 2+ ] ER. To test this hypothesis, we therefore monitored [Ca 2+ ] ER directly with an ERtargeted FRET indicator, cameleon 3er (3er) (44). At baseline, the 535/485 fluorescence emission ratios in cells co-expressing 3er and CRT were similar to the ratios found in cells expressing 3er alone (1.08 ± 0.07 vs ± 0.07, n = 16 matched cell pairs). Because the 3er indicator saturates at [Ca 2+ ] in excess of 100 µm (44), we repeated the experiments, this time expressing a lower affinity indicator, 4er, which could report [Ca 2+ ] ER between 10-4 and 10-2 M: the 535/485 ratios in cells co-expressing 4er and CRT were also similar to the ratios found in control cells (0.79 ± 0.04 vs ± 0.05, n = 6 matched cell pairs). These data indicate that overexpressed CRT does not measurably change the resting [Ca 2+ ] ER. When microinjected with InsP 3 (10-4 M in the pipette), control oocyte showed a 13

14 reversible decrease in 3er s 535/485 fluorescence emission ratio, indicating a decrease in [Ca 2+ ] ER (see Fig. 5A). As shown in Fig. 5B, cells co-expressing CRT reached a smaller InsP 3 -induced decline in 3er s 535/485 emission ratio than did control cells (2.8 ± 0.8% vs. 8.3 ± 0.6%, n = 16 matched cell pairs, p < 10-5 ), suggesting that CRT overexpression attenuates the InsP 3 -induced decline in [Ca 2+ ] ER. CRT s ability to maintain [Ca 2+ ] ER near resting levels uncouples Ca 2+ store depletion from intracellular InsP 3 levels in a novel way: unlike the Ca 2+ ATPase inhibitor thapsigargin, which deplete the stores at basal InsP 3 levels, overexpressed CRT prevented store depletion despite high InsP 3 levels. Recent evidence suggest that the role played by the InsP 3 R in Ca 2+ influx extends beyond simply lowering [Ca 2+ ] ER (25). In this context, our direct measurements of [Ca 2+ ] ER serve as a reminder that store depletion is required to stimulate Ca 2+ influx and that elevated InsP 3, by itself, is not sufficient. Effect of CRT on IICR. The simplest mechanism by which CRT could prevent the InsP 3 - induced decrease in [Ca 2+ ] ER would be to inhibit IICR. However, our data suggested that this was not the case with saturating concentrations of InsP 3 : in the cells where CRT had decreased the Ca 2+ influx-related Cl - current, there was no change in the initial Cl - currents due to IICR. Yet, in oocytes, CRT was previously reported to inhibit the Ca 2+ waves triggered by sub-maximal concentrations of Ins(1,4,5)P 3 (53). To test the effect of 14

15 CRT on the spatial aspects of IICR under experimental conditions where it could reduce Ca 2+ influx, we microinjected sub-maximal InsP 3 concentrations into oocytes loaded with fluorescent Ca 2+ indicators and visualized the resulting Ca 2+ waves with a confocal microscope (46,54). As shown in Fig. 6A, overexpression of CRT did not affect the amplitude, the velocity or the frequency of the repetitive Ca 2+ waves. To determine whether an increase in CRT levels changes the rate at which Ca 2+ is released from intracellular stores, we examined the fluorescence intensity along a narrow linear path running perpendicular to the wave front: by multiplying the average slope of the increasing fluorescence values at the wave front ( F / distance) by the wave s instantaneous speed ( distance / time), we obtained the rate at which [Ca 2+ ] rises at the wave front ( F / time) (32). Rate of rise in fluorescence intensity over baseline at the wave front was 38 ± 4% s -1 for control cells and 36 ± 2% s -1 for CRT-expressing cells (19 wave pairs, randomly chosen from 8 CRT/control cell pairs) suggesting similar rate of Ca 2+ release at the wave front (Fig. 6A). While our results that CRT expression did not change the amplitude of the Ca 2+ waves agree with those of Camacho et al., we did not find that CRT decreases Ca 2+ waves frequency (53). Many reasons could explain this difference: 1) we studied our cells 2-3 days after DNA injection whereas Camacho s group studied theirs after 5-7 days. Although we studied our cells at a time when CRT was already expressed maximally and could reduce Ca 2+ influx, we may have missed a time-dependent effect of CRT on the Ca 2+ waves; 2) we studied only those cells that had 15

16 proven exogenous protein expression and which had preserved plasma membrane electrical resistance. Camacho et al. did not screen individual cells for protein overexpression or for plasma membrane electrical integrity. Thus, the reported decrease in the frequency of Ca 2+ waves could not be unequivocally ascribed to an increase in CRT levels and may have been restricted to cells that were electrically leaky; 3) most of the experimental data reported by Camacho et al. was obtained in cells co-expressing the Ca 2+ ATPase SERCA2b. In a later publication, the same group reported that CRT- C, which had inhibited the Ca 2+ waves in cells co-expressing SERCA2b, had no effect on the Ca 2+ waves in cells co-expressing SERCAs lacking an ER-lumenal glycosylation site (55). Thus, their results may mainly reflect an interplay between CRT and SERCA2b (55). Our results suggest that under conditions where an increased amount of CRT within the ER can reduce the InsP 3 -induced decline in [Ca 2+ ] ER, CRT does not materially affect the mechanisms that initiate and propagate Ca 2+ waves. Thus, CRT does not appear to diminish the InsP 3 -induced decline in [Ca 2+ ] ER by inhibiting IICR. Effect of CRT on Ca 2+ uptake and/or Ca 2+ extrusion. CRT could blunt the InsP 3 -induced decrease in [Ca 2+ ] ER if it accelerated the reuptake of cytosolic Ca 2+ into the ER lumen. To investigate this alternative hypothesis, we first estimated the rate at which [Ca 2+ ] i returns to baseline following the passage of a Ca 2+ wave front using an analysis similar to that described in the preceding paragraph. We found that the rate of [Ca 2+ ] i decline was not 16

17 accelerated in cells expressing CRT (Fig. 6B). Next, we scanned the site of an intracellular injection of CaCl 2 (1 nl, 50 mm) with a single laser line (scanning rate = 500 Hz) in oocytes loaded with fluo 3. Fluorescence due to this exogenous addition of Ca 2+ returned to baseline at a slower rate in oocytes expressing CRT (Fig. 6B). To more specifically assay Ca 2+ uptake into the intracellular stores, we compared the ATPdependent 45 Ca 2+ uptake into microsomes isolated either from cells overexpressing CRT or from control cells. At 3 min, the time period over which the microsomes reach 50% of their total ATP-dependent 45 Ca 2+ uptake (33), we found a trend towards lower 45 Ca 2+ accumulation in microsomes from cells overexpressing CRT (Fig. 6B, p < 0.06). Together with the Ca 2+ injections experiments, these last results suggest that CRT overexpression slows the rate of Ca 2+ uptake into filled stores. In contrast, our data with the Ca 2+ waves suggest that CRT does not measurably affect the rate of Ca 2+ reuptake into InsP 3 -depleted stores. Our results are thus compatible with a previous report of CRT inhibiting the ER Ca 2+ ATPase (55) but further suggest that this inhibition can be overcome when [Ca 2+ ] ER decreases. Overall, these data do not support our alternative hypothesis that CRT reduces the InsP 3 -induced decline in [Ca 2+ ] ER by accelerating Ca 2+ reuptake/extrusion. CRT increases cellular and microsomal Ca 2+ -binding capacity. If CRT increases neither the magnitude of IICR nor the rate at which Ca 2+ is retrieved back into the ER, then CRT 17

18 could attenuate the InsP 3 -induced decrease in [Ca 2+ ] ER simply by increasing the store s Ca 2+ -buffering capacity: with more Ca 2+ to start with, more Ca 2+ should remain in the stores following InsP 3 stimulation. To measure the impact of CRT overexpression on cellular Ca 2+ content, we incubated oocytes with 45 Ca 2+ for 72 hours, a time period sufficient for the isotope to equilibrate across the cell s Ca 2+ -binding compartments: 45 Ca 2+ -related counts were 52 ± 14% higher in cells expressing CRT than they were in control cells (84 cell pairs from 5 different frogs, p < 0.02). Microsomes purified from groups of 10 CRT expressing oocytes had 45 Ca 2+ -related counts that were 59.3 ± 10% greater than controls (n = 4, p < 0.007). These data indicate that CRT overexpression increases whole cell and microsomal Ca 2+ content and thus support the notion that CRT acts as a high-capacity Ca 2+ buffer in vivo. Because 80% of the ionomycin-releasable Ca 2+ in these microsomes is InsP 3 -sensitive (33), these data further suggest that CRT levels can influence the capacity of the oocyte s InsP 3 -sensitive Ca 2+ pools. CRT s high-capacity Ca 2+ -binding domain is required to prevent InsP 3 -induced store depletion and to reduce IICI. To probe the relationship between CRT s Ca 2+ buffering properties and its ability to curb the InsP 3 -induced decrease in [Ca 2+ ] ER, we deleted the c- terminal domain, or C-domain (CRT- C), which is responsible for CRT s high Ca 2+ - binding capacity (13). To serve as a control, and to investigate the alternative possibility that CRT could regulate the InsP 3 -induced Ca 2+ signal by sensing a decrease in 18

19 [Ca 2+ ] ER (53), we also made a mutant lacking the P-domain (CRT- P), which contains CRT s only high-affinity Ca 2+ -binding site (13). Successful expression of both deletion mutants was confirmed by Western blotting (Fig. 1, lanes 3 and 4). At isotopic equilibrium, whole oocytes or microsomes extracted from oocytes expressing CRT- C had 45 Ca 2+ -related counts that were no different from controls (respectively 103 ± 8 % (25 cell pairs) and 91 ± 6 % (n = 3) of controls (100%)). In contrast, oocytes or microsomes from oocytes expressing CRT- P had greater 45 Ca 2+ counts than did controls (respectively 148 ± 13% (25 cell pairs, p <.004) and 174 ± 14% (n = 3, p <.01) of controls (100%)) (Fig. 7A). Thus, CRT- P increased cellular and microsomal Ca 2+ - binding capacity to an extent similar to that observed with wild-type CRT. These results confirm that it is the C-domain that confers on CRT the ability to bind large quantities of Ca 2+. Because this additional Ca 2+ binds to the C-domain with low affinity (K d ~ 2mM), it should therefore be readily available for release into the cytosol upon opening of the InsP 3 R. Yet, CRT overexpression did not affect the elevations in [Ca 2+ ] i due to IICR. Thus, additional releasable Ca 2+ appear to have little impact on the magnitude of IICR in cells that already own substantial intracellular Ca 2+ reserves. The InsP 3 -induced decline in 3er s 535/485 emission ratio was smaller in cells co- 19

20 expressing CRT- P than it was either in cells co-expressing CRT- C (2.6 ± 0.9% vs. 8.3 ± 1.4% decline respectively, n = 11 pairs, p <.002) or in control cells (7.9 ± 0.8%, n = 11) (Fig. 7B). As shown in Fig. 7C, CRT- P reduced the Cl - currents due to Ca 2+ influx whereas CRT- C did not; neither protein changed the magnitude of the initial Cl - current due to intracellular Ca 2+ release. Taken together, these data indicate that CRT relies on the C-domain both to blunt the InsP 3 -induced decline in [Ca 2+ ] ER and to reduce the [Ca 2+ ] i elevations due to IICI. CRT does not prevent thapsigargin-induced store depletion from fully activating Ca 2+ influx. If CRT acts primarily as a Ca 2+ buffer to reduce Ca 2+ influx, then a prolonged depletion of the Ca 2+ stores should eventually lead to a full activation of Ca 2+ influx. To test this hypothesis, we incubated oocytes with the Ca 2+ ATPase inhibitor thapsigargin for three hours (42), and directly measured the resulting whole cell Ca 2+ influx current according to the protocol of Yao and Tsien (43). As the tracings in Fig 8a exemplify, the magnitude of the thapsigargin-induced Ca 2+ influx current in cells overexpressing CRT was similar to that of controls (aggregate data for 7 cell pairs shown in Fig. 8b). Experiments with 3er-expressing oocytes confirmed that thapsigargin exposure decreases [Ca 2+ ] ER to a similar extent in control and in CRT-expressing cells (Fig. 8c). By demonstrating that store depletion can still fully stimulate Ca 2+ influx in cells 20

21 overexpressing CRT, these data further support the hypothesis that CRT controls InsP 3 - induced Ca 2+ influx by buffering [Ca 2+ ] ER. In summary, our results establish that an increase in calreticulin levels can reduce the InsP 3 -induced decline in [Ca 2+ ] ER, thereby confirming the proposal originally put forth by Pozzan et al. (26,28). The experimental results also link CRT s high Ca 2+ -buffering capacity to its ability both to prevent Ca 2+ stores depletion and to reduce Ca 2+ influx. Taken together, the results directly support the notion that changing levels of CRT can alter [Ca 2+ ] ER within ranges that are relevant to the cellular mechanisms that control InsP 3 - induced Ca 2+ influx. 21

22 References 1. Ostwald, T. J., and MacLennan, D. H. (1974) J.Biol.Chem. 249, Michalak, M., Milner, R. E., Burns, K., and Opas, M. (1992) Biochemical Journal 285, Mesaeli, N., Nakamura, K., Zvaritch, E., Dickie, P., Dziak, E., Krause, K. H., Opas, M., MacLennan, D. H., and Michalak, M. (1999) J Cell Biol 144(5), Dedhar, S., Rennie, P. S., Shago, M., Hagestelijn, C.-Y. L., Yang, H., Filmus, J., Hawley, R. G., Bruchovsky, N., Cheng, H., Matusik, R. J., and Giguère, V. (1994) Nature 367, Burns, K., Duggan, B., Atkinson, E. A., Famulski, K. S., Nemer, M., Bleacklsy, R. C., and Michalak, M. (1994) Nature 367, Leung-Hagesteijn, K., Milankov, C.-Y., Michalak, M., and Wilkins, J. (1994) Journal of Cell Science 107, Opas, M., Szweczenko-Pawlikowska, M., Jass, G. H., Mesaeli, N., and Michalak, M. (1996) J.Cell Biol. 135, Michalak, M., Burns, K., Andrin, C., Mesaeli, N., Jass, G. H., Busaan, J. L., and Opas, M. (1996) J Biol Chem 271(46), Perrone, L., Tell, G., and Di Lauro, R. (1999) J Biol Chem 274(8), Dedhar, S. (1994) Trends Biochem.Sci. 19,

23 11. Coppolino, M. G., Woodside, M. J., Demaurex, N., Grinstein, S., St-Arnaud, R., and Dedhar, S. (1997) Nature 386, Fadel, M. P., Dziak, E., Lo, C. M., Ferrier, J., Mesaeli, N., Michalak, M., and Opas, M. (1999) J Biol Chem 274(21), Krause, K.-H., and Michalak, M. (1997) Cell 88, Zhang, J. X., Braakman, I., Matlack, K. E., and Helenius, A. (1997) Mol Biol Cell 8(10), Fujino, I., Yamada, N., Miyawaki, A., Hasegawa, M., Furuichi, T., and Mikoshiba, K. (1995) Cell Tissue Res. 280, Peterson, J., Ora, A., Van, P. N., and Helenius, A. (1995) Molecular Biology of the Cell 6, Nauseef, W. M., McCormick, S. J., and Goedken, M. (1998) J Biol Chem 273, Thomas, A. P., Bird, G. S., Hajnoczky, G., Robb-Gaspers, L. D., and Putney, J. W. (1996) FASEB J. 10, Randriamampita, C., and Tsien, R. Y. (1993) Nature 364, Parekh, A. B., Terlau, H., and Stühmer, W. (1993) Nature 384, Patterson, R. L., van Rossum, D. B., and Gill, D. L. (1999) Cell 98, Yao, Y., Ferrer-Montiel, A. V., Montal, M., and Tsien, R. Y. (1999) Cell 98,

24 23. Putney, J. W. (1997) Cell Calcium 21, Kiselyov, K., Xu, X., Mozhayaeva, G., Kuo, T., Pessah, I., Mignery, G., Birnbaumer, L., and Muallem, S. (1998) Nature 396, Ma, H.-T., Patterson, R. L., van Rossum, D. B., Birnbaumer, L., Mikoshiba, K., and Gill, D. L. (2000) Science 287, Bastianutto, C., Clementi, E., Docazzi, F., Podini, P., De Georgi, F., Rizzutto, R., Meldolesi, J., and Pozzan, T. (1995) J.Cell Biol. 130, Mery, L., Mesaeli, N., Michalak, M., Opas, M., Lew, D., and Krause, K.-H. (1996) J.Biol.Chem. 271, Fasolato, C., Pizzo, P., and Pozzan, T. (1998) Mol Biol Cell 9(6), Denning, G. M., Leidal, K. G., Holst, V. A., Iyer, S. S., Pearson, D. W., Clark, J. R., Nauseef, W. M., and Clark, R. A. (1997) Blood 90, Swick, A. G., Janicor, M., Cheneval-Kastelic, T., McLenithan, J. C., and Lane, M. D. (1992) Proc.Natl.Acad.Sci.U.S.A. 89, DeLisle, S., Krause, K.-H., Denning, G., Potter, B. V. L., and Welsh, M. J. (1990) J.Biol.Chem. 265, DeLisle, S., Blondel, O., Longo, F. J., Schnabel, W. E., Bell, G. I., and Welsh, M. J. (1996) Am.J.Physiol. 270, C1255-C Parys, J. B., Sernett, S. W., DeLisle, S., Snyder, P. M., Welsh, M. J., and Campbell, K. P. (1992) J.Biol.Chem. 267,

25 34. Moreau, M., Vilain, J. P., and Guerrier, P. (1980) Dev.Biol. 78, Robinson, K. R. (1985) Dev.Biol. 109, Han, J. K., and Nuccitelli, R. (1990) J.Cell Biol. 110, Parker, I., and Miledi, R. (1987) Proc.R.Soc.Lond. B231, Takahashi, T., Neher, E., and Sakmann, B. (1987) Proc.Natl.Acad.Sci.U.S.A. 84, Miledi, R., and Parker, I. (1989) J.Physiol.(Lond) 415, Brooker, G., Seki, T., Croll, D., and Wahlestedt, C. (1990) Proc.Natl.Acad.Sci.U.S.A. 87, Picard, A., Cavadore, J.-C., Lory, P., Bernengo, J.-C., Ojeda, C., and Dorée, M. (1990) Science 247, Petersen, C. C. H., and Berridge, M. J. (1994) J.Biol.Chem. 269, Yao, Y., and Tsien, R. Y. (1997) J Gen Physiol 109(6), Miyawaki, A., Liopis, J., Helm, R., McCaffery, J. M., Aeams, J. A., Ikura, M., and Tsien, R. Y. (1997) Nature 388, Lipp, P., and Niggli, E. (1993) Cell Calcium 14, DeLisle, S., and Welsh, M. J. (1992) J.Biol.Chem. 267, Parys, J. B., McPherson, S. M., Mathews, L., Campbell, K. P., and Longo, F. J. (1994) Developmental Biology 161, Parker, I., and Miledi, F. R. S. (1986) Proc.R.Soc.Lond. B 228,

26 49. Gillo, B., Lass, Y., Nadler, E., and Oron, Y. (1987) J.Physiol.Lond. 392, Snyder, P. M., Krause, K.-H., and Welsh, M. J. (1988) J.Biol.Chem. 263, Hartzell, H. C. (1996) Journal of General Physiology 108, DeLisle, S., Marksberry, E. W., Bonnett, C., Jenkins, D. J., Potter, B. V. L., Takahashi, M., and Tanzawa, K. (1997) J.Biol.Chem. 272, Camacho, P., and Lechleiter, J. D. (1995) Cell 82, Lechleiter, J. D., and Clapham, D. E. (1992) Cell 69, John, L. M., Lechleiter, J. D., and Camacho, P. (1998) J Cell Biol 142(4),

27 Footnotes 1 This work was supported by grants from the US Department of Veterans Affairs (S.D. and R.A.C.). S.D. is an Established Investigator at the American Heart Association. 2 The abbreviations used are: CaM: calmodulin; CRT: calreticulin, ER: endoplasmic reticulum; [Ca 2+ ]: Ca 2+ concentration; [Ca 2+ ] i : free cytosolic [Ca 2+ ]; [Ca 2+ ] ER : free ER lumenal [Ca 2+ ]; FRET: fluorescence resonance energy transfer; GFP (YFP, CFP): green (yellow, cyan) fluorescent protein; HEPES: N-[2-hydroxyethyl]piperazine-N -[2- ethanesulfonic acid]; IICI: InsP 3 -induced Ca 2+ influx; IICR: InsP 3 -induced Ca 2+ release; InsP 3 : D-myo inositol 1,4,5-trisphophate ; InsP 3 R: inositol 1,4,5-trisphophate receptor ; PCR: polymerase chain reaction; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis. 27

28 Figure Legends Figure 1. Overexpression of CRT in Xenopus oocyte. A) Each lane represents an identical amount of solubilized microsomal protein submitted to SDS/PAGE, transferred to nitrocellulose and blotted with a polyclonal antibody against HL60-CRT. When compared to controls (lane 1), CRT (bands facing the closed arrow) was increased in cells microinjected with pmt3-crt (lane 2). Note the appearance of new bands (open arrow) in cells microinjected with pmt3-crt- P (doublet in lane 3) or pmt3-crt- C (lane 4). Figure 2. Localization of CRT by immunofluorescence. Anti-CRT staining shows a marked increase in fluorescence signal in CRT-expressing oocytes (lower panels) compared to controls (upper panels). The reticular pattern and the decreasing fluorescence from the animal pole (panels A and D) to the equatorial region (panels B and E) and to the vegetal pole (panels C and F) is typical of the ER distribution in oocytes. Oocytes exposed only to the secondary antibody were negative. Figure 3. Localization of CRT by immunogold staining. Electron microscopy at the animal pole of an oocyte overexpressing CRT. Gold particles targeted against an anti-crt antibody are associated with cisternae of endoplasmic reticulum (arrowheads). Figure 4. Effect of CRT overexpression on the [Ca 2+ ] i elevations due to Ca 2+ influx. Successive experiments performed in a control cell (A) and a CRToverexpressing cell (B). Each tracing represent the Cl - current response to an intracellular 28

29 injection of Ins(1,4,5)P 3 (arrow) as a function of time. Downward deflection (inward current) represents an increase in [Ca 2+ ] i. Note that the slow component of the biphasic response in the control cell (A) can be inhibited by lowering the extracellular [Ca 2+ ] from 6 to 0.1 mm (bar) and is therefore due to Ca 2+ influx. The Cl - current due to Ca 2+ influx is markedly diminished in the cell overexpressing CRT (B). Figure 5. Effect of CRT-overexpression on [Ca 2+ ] ER. A) In a cell expressing the 3er FRET indicator and injected with InsP 3 (arrow), the emission intensity increases at 485 nm (upper tracing, left axis) and decreases at 535 nm (middle tracing, left axis). Thus, the 535/485 fluorescence intensity ratio (lower tracing, right axis) decreases reversibly as function of time, indicating a decrease in [Ca 2+ ] ER. B) Peak decline in the 3er s 535/485 ratio due to an injection of InsP 3 is more pronounced in cells expressing 3er alone (closed circles on the left) than in cells co-expressing 3er and CRT (open circles on the right). Baseline 535/485 ratio were normalized to 1. Figure 6. Effect of CRT overexpression on InsP 3 -induced Ca 2+ waves and on Ca 2+ uptake. Each bar represent the mean value of a measured parameter in CRToverexpressing cells as a percent of control values. A) Effect of CRT overexpression on InsP 3 -induced Ca 2+ waves. The five parameters measured were (bars from left to right): 1) basal [Ca 2+ ] before the passage of a Ca 2+ wave; 2) peak [Ca 2+ ] at the wave front; 3) instantaneous wave velocity; 4) frequency of the repetitive waves; 5) rate of Ca 2+ release at the wave front. B) Effect of CRT overexpression on Ca 2+ reuptake/extrusion. The 29

30 three parameters measured were the rate at which peak [Ca 2+ ] i decreases following either the passage of a Ca 2+ wave (bar 1) or an intracellular injection of CaCl 2 (bar 2) and the ATP-dependent 45 Ca 2+ accumulation into purified microsomes (bar 3). The number of Ca 2+ wave pairs compared across 8-11 matched cell pairs is indicated above bars 1,2,3 and 5 of panel A and bar 1 of panel B. Number of experimental pairs is indicated above bar 4 of panel A and bars 2 and 3 of panel B. Star indicates statistically significant difference compared to controls (p < 0.05). Except for slowing the return to basal [Ca 2+ ] i following a Ca 2+ injection, CRT overexpression affected none of the measured parameters. Figure 7. The C-domain mediates the functional effects of CRT. Consequence of overexpressing either full-length CRT, CRT- P or CRT- C on: A) 45 Ca 2+ uptake into whole cells (filled bars) or microsomes (open bars), expressed as a percent of control values; B) InsP 3 -induced decrease in [Ca 2+ ] ER, expressed as a percent decrease from 3er s baseline 535/485 emission ratio; C) magnitude of the Ca 2+ -gated Cl - current due to IICR (closed bars) or IICI (hatched bars), expressed as a percent of control values. Star indicates statistically significant difference (p < 0.01). Note that CRT- P, but not CRT- C, matches CRT s ability to increase the cellular and microsomal Ca 2+ -binding capacity (panel A), prevent the InsP 3 -induced decline in [Ca 2+ ] ER (panel B) and the [Ca 2+ ] i elevations due to IICI (panel C). 30

31 Figure 8. Thapsigargin decreases [Ca 2+ ] ER and fully activates Ca 2+ influx in CRTexpressing cells. A and B) following thapsigargin exposure, an inward current (downward deflection) is induced by switching the divalent cation in the bath solution from Mg 2+ (70 mm) to Ca 2+ (70 mm) (bar in A). Note that this current is of similar magnitude in control (left tracing in A, closed bar in B) and in CRT-expressing oocytes (right tracing in A, open bar in B); C) thapsigargin induced a similar decline in 3er s 535/485 fluorescence ratio in control (closed bar, n = 10) and CRT-expressing oocytes (open bar, n = 12). 31

32 68 Controls CRT CRT- P CRT- C

33 Animal Pole Equator Vegetal Pole A B C D E F

34

35 A Ins(1,4,5)P 3 ++ low [Ca ] 100 na B Ins(1,4,5)P 3 2 min ++ low [Ca ] 100 na 2 min

36 A 1.3 Emission intensity (x 10 5 counts/s) InsP ± 20 nm 535 ± 15 nm 535/ X 0.9 Emission ratio Time (min) B Normalized emission ratio Baseline InsP 3 J J J J J Baseline InsP 3 E E E E 0.8 Controls CRT

37 A % of controls [Ca ] Baseline Ca 2+ Ca 2+ [Ca ] 2+ Peak Waves Velocity Waves Frequency Ca 2+ Release rate B 19 % of controls Ca 2+ Reuptake at Wavefront Ca 2+ Reuptake after Injection 45 Ca 2+ Reuptake into Microsomes

38 A B 45 Ca 2+ uptake (% of controls) 535/485 ratio (% change) Controls CRT CRT- P CRT- C whole cells microsomes C Ca 2+ -gated Cl - current (% of controls) IICR IICI 0 Controls CRT CRT- P CRT- C

39 A Control CRT Ca2+ Ca2+ 50 na 1 min B Ca 2+ influx current (na) C 535/485 ratio (% change) ControlsCRT