Risk of Norovirus Transmission Linked to the Consumption of Raw Vegetables
|
|
- Bruno Lester
- 6 years ago
- Views:
Transcription
1 ILSI SEA Region 6th Asian Conference on Food and Nutrition Safety (Nov 2012) Risk of Norovirus Transmission Linked to the Consumption of Raw Vegetables Tuan Zainazor Tuan Chilek, Cheah Yoke Kqueen and Son Radu University Putra Malaysia
2 NOROVIRUS Noroviruses (Genus Norovirus, Family Caliciviridae) are a genetically diverse group of single-stranded RNA. Small round structured Non-enveloped viruses that cause acute gastroenteritis (an inflammation of the stomach and intestines) in humans. Noroviruses are named after the original strain Norwalk virus, which caused an outbreak of gastroenteritis in a school in Norwalk, Ohio, in 1968.
3 Classification of Norovirus Noroviruses can be classified into five major groups: Prototype Norwalk virus (GI) - human Prototype Snow Mountain Agent (GII) human and swine Prototype Bovine Enteric Calicivirus (GIII) - bovine Prototype Alphatron and Fort Lauderdale virus (GIV) human Prototype Murine Norovirus (GV) - murine (D Souza and Jaykus, 2006)
4 Transmission of enteric (Norovirus) virus These viruses are transmitted mainly via fecal oral route through person-to-person contact or consumption of contaminated food, hospital, cruise ship, prison, nursing home, age-care homes, holiday camp, caterers (Japan reported 19% identified to caterer as asymptomatic carriers) Fruits and vegetables contamination with enteric virus can occur before the product reaches food service establishment Transmission of enteric viruses;koopmans M, Duizer E (2004), Int J Food Microbiol 90:23-41.
5
6 Detection of Norovirus Today, Noroviruses are recognized as one of the most common cause of infectious gastroenteritis among persons of all ages. For example, they are responsible for <50% of all foodborne gastroenteritis outbreaks in the United States. Characterization and classification of Norovirus based on reverse transcription-polymerase chain reaction (RT-PCR), sequencing and phylogenetic analysis can be carried out in standard laboratory. For example, in stool specimens, RT-PCR had the ability to detect viral particles/ ml (CDC, 2001).
7 WHY RAW VEGETABLES? Salad vegetables are one of the popular dishes among Malaysian population, usually eaten raw in their meals Food samples examined for food poisoning and outbreak investigation are normally free from pathogenic organism (bacteria) even though the consumers have acute gastroenteritis. Therefore, virus could be a suspected agent, especially Norovirus which is commonly associated with acute gastroenteritis.
8 Percentage of estimated foodborne illness attributable by agent Bacteria 30% Viral 67% Protozoan 3% *Mead et al., 1999
9 Foodborne Hazards Hazard Est. Cases Deaths Norwalk virus 23,000,000 na Campylobacter 2,453, % Salmonella 1,412, % C. perfringens 248, % S. aureus 185, % E. coli O157:H7 73, % L. monocytogenes 2,518 20% C. botulinum % (Centers for Disease Control and Prevention, 2001)
10 Estimated number of cases of Norovirus per year in United States Route Cases Reference Food 6,900,000 Mead et al., 1999 Recreational 6,900,000 U.S. Census, 2000 Water Drinking Water 3,584,000 Haas et al., 1999 Others 5,616,000 Mead et al., 1999 Total 23,000,000
11 SCOPE To establish standard methodology in detecting of Norovirus in raw vegetables using RT-PCR Technique To provide the baseline data for Norovirus contamination in raw vegetables at retail level To characterize the Genogroup of Norovirus using RT- PCR and sequencing
12 Method optimization to obtain positive control from clinical specimens - Stools - Vomitus - Throat swab -Viral RNA extracted using QIAamp Viral RNA Kit (QIAGEN) -Reverse Transcription (50 o C, 30 min) -Initial PCR (95 o C,15 min) -Denaturation (94 o C,45 sec) -Annealing (52 o C,30 sec) -Extending (72 o C,45 sec) -40 cycles SAMPLES RNA EXTRACTION NOROVIRUS DETECTION Norovirus genogroup Primer Sequence Amplicon size I MON TGG ACI CGY GGI CCY AAY CA bp MON GAA SCG CAT CCA RCG GAA CAT 3 II MON TGG ACI AGR GGI CCY AAY CA bp MON GAA YCT CAT CCA YCT GAA CAT 3
13 DEVELOPMENT OF NOROVIRUS DETECTION METHOD IN RAW VEGETABLES Sample collection and preparation Detachment of viruses from food surface FIVE MAIN STEPS Enhance Concentration of RNA Viral Extraction Detection using one-step RT-PCR
14 Sample collection and preparation English Name Local Name Scientific Name Indian pennywort Pegaga Centella asiatica Water spinash Kangkung Ipomoea aquatica Mung bean sprout Tauge Vigna radiata Vietnamese coriander Kesum Poligonum minus Japanese parsley Selom Oenanthe stolonifera Wild cosmos Ulam raja Cosmos caudatus Celery Daun sup/daun saderi Apium graveolens Green onion Daun bawang Allium cepa
15 Celery Mung bean sprout Indian pennywort Green onion Vietnamese coriander Water spinash Wild cosmos Japanese parsley
16 Detachment of viruses from food surface - using Tryptose Phosphate Broth Glycine buffer ph 9.0 (TPBG) 25 g sample (about 2-3 cm) TPBG (50 ml) 25 mm MgCl 2 (500 µl) Shake for 15 mins Transfer into 50 ml sterile tube Centrifuge at 4000 rpm for 10 mins
17 Enhance Concentration of RNA - using negative charge membrane filter Filter (negative charge membrane filter) Rinse with H 2 SO 4 (8 ml) Transfer filter in sterile petri dish Put TPBG (6 ml) Transfer liquid into 12 ml test tube Adjust ph with 1N HCl (ph7) Centrifuge at 4000 rpm for 1 hr Agitate at 60 rpm, 15 mins
18 Viral Extraction - using Qiagen RNeasy mini kit Transfer 150 µl into 2 ml microtube Add 450 µl of RLT-ßmercaptoethanol solution Add 15 µl of 10% SDS Vortex for 15 sec. Put protenase K (0.75 µl) Heat for 2 mins (56 o C) Incubate for 2 mins (RT) Incubate at RT for 5 mins Incubate for 1 hr at 37 o C Extract using Qiagen RNeasy mini kit RNA solution
19 PCR Conditions Detection using one-step RT-PCR - using One-step RT-PCR Master Mixture preparation Components Volume per reaction RNase free water 10.0 µl Amplification conditions Reverse transcriptive condition 30 mins 50 o C 5x Qiagen One-step RT-PCR 5.0 µl buffer dntp mix (containing 10 mm of each dntp) Forward primer (MON 431 or MON 432) Reverse primer (MON 433 or MON 434) Qiagen one-step RT-PCR enzyme mix 1.0 µl 1.5 µl 1.5 µl 1.0 µl Template RNA 5.0 µl Final volume 25.0 µl Initial PCR inactivation step 3-step cycling : Denaturation Annealing Extension Final extension Number of cycles : mins 95 o C 45 sec 94 o C 30 sec 52 o C 45 sec 72 o C 10 mins 72 o C
20
21 NOROVIRUS CONTAMINATION IN RAW VEGETABLES AT RETAIL LEVEL Sampling of raw vegetables from selected selling point Local Name No of Samples Total Wet market Night market Grocery store Supermarket Pegaga Kangkung Tauge Kesum Selom Ulam raja Daun sup Daun bawang Total 512
22 RELATEDNESS OF DIFFERENT NOROVIRUS STRAINS USING GENOMIC SEQUENCING Gel Extraction Cloning QIAGEN PCR Cloning Kit Plasmid purification QIAprep Miniprep Kit (QIAGEN) Sequence comparison BLAST Sequence alignment Phylogenetic tree
23 RESULTS Results of Norovirus detection in clinical specimens Type of sample ID No. Results GI GII Stool S1 S10 Not Detected Not Detected Vomitus V1 V5 Not Detected Not Detected T1 T2 Not Detected Not Detected Throat Swab T3 Detected Not Detected T4 T9 Not Detected Not Detected T10 Detected Not Detected
24 Representative of agarose gel of Norovirus genogroup I detection in Throat swab sample (T1-T10). NC, negative control; M, 100bp marker T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 M NC 1000bp 900bp 300bp 213bp 200bp 100bp
25 Representative agarose gel for Norovirus genogroup I detection in Vietnamese Coriander (1-8). PC (positive control); NC, negative control; M, 100bp marker
26 Results of method development using positive and negative control Sample name No. of sample No. of positive sample Genogroup I Genogroup II Positive control (+) Negative control (-) Mung bean sprout (Tauge) Water spinach (Kangkung) Vietnamese coriander (Kesum) Japanese parsley (Selom) Wild cosmos (Ulam raja) Indian pennywort (Pegaga) Celery (Daun Sup) Green onion (Green onion)
27 Prevalence data of Norovirus Genogroup I in raw vegetables Type of samples No of samples Positive (Genogroup I) Prevalence (%) Pegaga Kangkung Tauge Kesum Selom Ulam raja Daun sup Daun bawang
28 Incidence of Norovirus GI in Salad Vegetables Pegaga Kangk ung Tauge Kesom Selom Ulam Raja Daun Sup Daun Bawang Prevalence (%) Pegaga Kangkung Tauge Kesom Selom Ulam Raja Daun Sup Daun Bawang Types of sample * Norovirus Genogroup II was not detected from all samples
29 Norovirus genogroup I detection in raw vegetables from selected sampling location 25 Tota al P revalence (% ) Mung bean sprout Water spinash Vietnamese coriander Japanese parsley Wild cosmos Indian pennywort Celery Types of Raw Vegetables Green onion Grocery Stores Wet Market Night Market Supermarket Prevalence data of Norovirus Genogroup I detection in raw vegetables from selected sampling location.
30 Observation during sampling The condition of raw vegetables display at the selected grocery stores during sampling. The condition of raw vegetables display at the selected supermarket during sampling.
31 Relatedness of different Norovirus strains using genomic sequencing Sequence Alignment Norovirus Pegaga TGGACGCGCGGGCCTAATCATTCAGATCCATCAGAGACTCTAGTGCCACA 50 Norovirus Kangkung TGGACGCGTGGGCCTAATCATTCAGATCCATCAGAGACTCTAGTGCCACA 50 Norovirus Tauge TGGACGCGTGGGCCTAACCATTCAGATCCATCAGAGACTCTAGTGCCACA 50 Norovirus Kesum TGGACGCGTGGGCCCAATCATTCAGATCCATCAGAGACTCTAGTGCCACA 50 ************************************************** Norovirus Pegaga CACTCAAAGAAAA-TACAGTTGATTTCACTTCTAGGGGAAGCTTCACTCC 99 Norovirus Kangkung CACTCAAAGAAAAATACAGTTGATTTCACTTCTAGGGGAAGCTTCACTCC 100 Norovirus Tauge CACTCAAAGAAAAATACAGTTGATTTCACTTCTAGGGGAAGCTTCACTCC 100 Norovirus Kesum CACTCAAAGAAAAATACAGTTGATTTCACTTCTAGGGGAAGCTTCACTCC 100 ************************************************* Norovirus Pegaga ATGGTGAGAAATTTTACAGAAAGATTTCCAGCAAGGTCATACATGAAATC 149 Norovirus Kangkung ATGGTGAGAAATTTTACAGAAAGATTTCCAGCAAGGTCATACATGAAATC 150 Norovirus Tauge ATGGTGAGAAATTTTACAGAAAGATTTCCAGCAAGGTCATACATGAAATC 150 Norovirus Kesum ATGGTGAGAAATTTTACAGAAAGATTTCCAGCAAGGTCATACATGAAATC 150 ************************************************** Norovirus Pegaga AAGACTGGTGGATTGGAAATGTATGTCCCAGGATGGCAGGCCATGTTCCG 199 Norovirus Kangkung AAGACTGGTGGATTGGAAATGTATGTCCCAGGATGGCAGGCCATGTTCCG 200 Norovirus Tauge AAGACTGGTGGATTGGAAATGTATGTCCCAGGATGGCAGGCCATGTTCCG 200 Norovirus Kesum AAGACTGGTGGATTGGAAATGTATGTCCCAGGATGGCAGGCCATGTTCCG 200 ************************************************** Norovirus Pegaga TTGG-ATGCGGTTAT Norovirus Kangkung TTGG-ATGCGGTTATCTT Norovirus Tauge TTGG-ATGCGGTTC Norovirus Kesum TTGG-ATGCGATCT **************************
32 GI Phylogenetic analysis of Norovirus strains based on RNA-dependent RNA-polymerase region (RdRp); Tree-Neighbour joining using BLOSUM62. The phylogenetic tree is based on sequences from different types of raw vegetables collected in this study.
33 Conclusion The first kind of study to detect the present of Norovirus in raw vegetables in Malaysia RT-PCR method is an excellent choice for the detection of Norovirus It is evident that the NorovirusGenogroup 1 contributes to the acute gastroenteritis diseases in Malaysia (2 of the 10 throat swabs samples have been detected positive for the presence of Norovirus) Norovirus Genogroup 1 was detected from salad vegetables which is common in human infection This result highlights the risk associated with the consumption of raw vegetables contaminated with Norovirus and that raw vegetables could be a medium or transmission vehicle of Norovirus Avoid contamination of Norovirus eliminate/reduce through proper washing and handling to detach viral particle from salad vegetables surfaces
34 Output from this study Norovirus detection method was established Baseline data on Norovirus made available Proposed this methodology to Ministry of Health Malaysia Training for MOH food laboratory staff National monitoring program (year 2012) Proposed guidelines on Norovirus contamination
35 Training NPHL, Sungai Buloh - Lab staff (7 March 2012). Starcruise, Penang Cabin crew (29 June 2011). Unisel, Shah Alam Workshop participant (17 Jan 2011 & 24 Jan 2011).
36 ACKNOWLEDGEMENTS Food Quality and Safety Division Financial Support National Public Health Laboratory, Sungai Buloh University Putra Malaysia
37
Norovirus, epidemiology, shellfish and the public health hazard. John Harris
Norovirus, epidemiology, shellfish and the public health hazard John Harris Norovirus Family : Caliciviridae Non-enveloped small round structured virus (27-32 nm diameter) Genome: positive sense ssrna
More informationNOROVIRUS A Food Production Perspective
1 NOROVIRUS A Food Production Perspective Tom Ford Vice President, Food Safety Ecolab November 2012 Photo courtesy: Dr. B.V.V. Prasad, Baylor College of Medicine Settings of Confirmed Norovirus Outbreaks,
More informationDiagnosis and Typing of Norovirus. Dr. Samir Patel Msc PhD Clinical Microbiologist
Diagnosis and Typing of Norovirus Dr. Samir Patel Msc PhD Clinical Microbiologist Objectives Characteristics of Norovirus Methods for detection of Norovirus Rapid test for detection of Norovirus Current
More informationPreventing Cruise Ship Foodborne Illness Outbreaks. By Madison Dobson
No. 7 Preventing Cruise Ship Foodborne Illness Outbreaks By Madison Dobson March 26, 2014 NDFS 445 INTRODUCTION It is popular to take a vacation to different locations around the world on a cruise. According
More informationPathogens and Grazing Livestock
Pathogens and Grazing Livestock Steve Ensley DVM, PhD 10/16/09 Water Borne Pathogens This presentation will have a specific emphasis on water borne pathogens. NUMBERS OF IOWA WATER SOURCES WITH Stream/River
More informationOregon Department of Human Services HEALTH EFFECTS INFORMATION
Oregon Department of Human Services Office of Public Health Systems (503) 731-4030 Emergency 800 NE Oregon Street #611 (503) 731-4381 Portland, OR 97232-2162 (503) 731-4077 FAX (503) 731-4031 TTY-Nonvoice
More informationAlberta Agriculture and Forestry s Response to the 2014 Outbreak of E. coli O157:H7 in Alberta
Alberta Agriculture and Forestry s Response to the 2014 Outbreak of E. coli O157:H7 in Alberta Jeff Stewart Alberta Agriculture and Forestry Industry Days April 9, 2016 E. coli O157:H7: What is it and
More informationMicrobiological Analysis of Food Contact Surfaces in Child Care Centers
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2008, p. 6918 6922 Vol. 74, No. 22 0099-2240/08/$08.00 0 doi:10.1128/aem.00547-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Microbiological
More informationMicrobiological Analysis of Food Contact Surfaces in Child Care Centers
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2008, p. 6918 6922 Vol. 74, No. 22 0099-2240/08/$08.00 0 doi:10.1128/aem.00547-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Microbiological
More informationNo Longer Fond of the Local Pond
No Longer Fond of the Local Pond by Stephanie L. Luster-Teasley, Janie G. Locklear, and Niva S. King Department of Civil, Architectural and Environmental Engineering North Carolina A&T State University,
More informationUSE OF BIOFERTILIZERS IN BERRY FIELD AND FOOD SAFETY
USE OF BIOFERTILIZERS IN BERRY FIELD AND FOOD SAFETY Meijun Zhu, Benedict Chris, Chad Eugene, Margaret Drennan Washington State University FOODBORNE ILLNESS IS A SIGNIFICANT BURDEN There are 1400 foodborne
More informationFoodborne Diseases Active Surveillance Network (FoodNet)
Foodborne Diseases Active Surveillance Network (FoodNet) Elaine Scallan, PhD Foodborne Diseases Active Surveillance Network (FoodNet) Foodborne and Diarrheal Disease Branch Centers for Disease Control
More informationAn Analysis of Water Quality in the Colorado River, ; An Investigation Into Recurring Outbreaks of Norovirus Among Rafters
Wilderness and Environmental Medicine, 20, 6 13 (2009) ORIGINAL RESEARCH An Analysis of Water Quality in the Colorado River, 2003 04; An Investigation Into Recurring Outbreaks of Norovirus Among Rafters
More informationISPUB.COM. Microbiological Quality Of Sweetmeat With Special Reference To Staphylococci. S Chakraborty, A Pramanik, A Goswami, R Ghosh, S Biswas
ISPUB.COM The Internet Journal of Microbiology Volume 1 Number 1 Microbiological Quality Of Sweetmeat With Special Reference To Staphylococci S Chakraborty, A Pramanik, A Goswami, R Ghosh, S Biswas Citation
More informationTeleclass Sponsored by Webber Training, Hosted by Paul Webber,
Slide 1 Disease Transmission and Control in the Home Setting Charles P. Gerba Departments of Microbiology and Immunology and Epidemiology and Biostatistics University of Arizona Tucson, AZ 85721 Webber
More informationFood Microbiological Examination: Enumeration of Coliforms
Translated English of Chinese Standard: GB4789.3-2010 Translated by: www.chinesestandard.net Wayne Zheng et al. Email: Sales@ChineseStandard.net NATIONAL STANDARD GB OF THE PEOPLE S REPUBLIC OF CHINA GB
More informationIMPACT OF WASTE WATER TREATMENTS ON REMOVAL OF NOROVIRUSES FROM SEWAGE. 1 March 2012
IMPACT OF WASTE WATER TREATMENTS ON REMOVAL OF NOROVIRUSES FROM SEWAGE 1 March 2012 Impact of wastewater treatments on removal of noroviruses from sewage defra project reference WT0924 Elaine Connolly,
More informationOverview of Microbial Indicator Monitoring Lab Methods. Jim Ferretti, USEPA Region 2 DESA, Laboratory Branch May 23, 2018
Overview of Microbial Indicator Monitoring Lab Methods Jim Ferretti, USEPA Region 2 DESA, Laboratory Branch May 23, 2018 Water Contamination and Public Health 1854- John Snow mapped and correlated incidence
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION ANSI National Accreditation Board 11617 Coldwater Road, Fort Wayne, IN 46845 USA This is to certify that Applied Industrial Microbiology 2321 South Melrose Drive Vista, CA
More informationGB Translated English of Chinese Standard: GB NATIONAL STANDARD OF THE
Translated English of Chinese Standard: GB4789.3-2016 www.chinesestandard.net Sales@ChineseStandard.net GB NATIONAL STANDARD OF THE PEOPLE S REPUBLIC OF CHINA GB 4789.3-2016 National food safety standard
More informationRECENT OBSERVATIONS ENABLING BETTER MANAGEMENT OF SAFETY RISKS ASSOCIATED WITH PRODUCE AND PECANS
RECENT OBSERVATIONS ENABLING BETTER MANAGEMENT OF SAFETY RISKS ASSOCIATED WITH PRODUCE AND PECANS Larry R. Beuchat Center for Food Safety, University of Georgia Joint Meeting of Governor s Food Safety
More informationLearning Styles: Visual, auditory, kinesthetic, and synthesis
Miriam Sawyer Tate High School/ Escambia County, FL Title: Let s get sterile and learn to problem solve!!!! Key Questions: (Unit on safety and scientific method) 1. How well do we wash our hands and why
More informationProject Title Assessing postharvest food safety risks and identifying mitigation strategies for foodborne pathogens in pistachios
CPS 2013 RFP FINAL PROJECT REPORT Project Title Assessing postharvest food safety risks and identifying mitigation strategies for foodborne pathogens in pistachios Project Period January 1, 2014 December
More informationEvaluation copy. Fecal Coliform. Computer INTRODUCTION
Fecal Coliform Computer 9 INTRODUCTION The concentration of fecal coliform bacteria in water is measured to determine the likelihood of contamination by microbiological organisms. While fecal coliform
More informationCalifornia Leafy Greens Research Board Final Report April 1, 2008 to March 31, 2009
California Leafy Greens Research Board Final Report April 1, 28 to March 31, 29 I. Abstract Project Title: Survival of attenuated Escherichia coli O157:H7 ATCC 7728 in fieldinoculated lettuce. Project
More informationLoyalsock Creek Bacterial Coliforms. Presented By: Dr. Mel Zimmerman Clean Water Institute Lycoming College Matthew Bennett Jim Rogers
Loyalsock Creek Bacterial Coliforms Presented By: Dr. Mel Zimmerman Clean Water Institute Lycoming College Matthew Bennett Jim Rogers What is E. coli? Short for Escherichia coli (a bacteria) It is a
More informationMicrobial Hygiene Considerations with Mechanical Harvesting of Blueberries
Microbial Hygiene Considerations with Mechanical Harvesting of lueberries Renée Allen UGA Extension, Alma, GA Dr. Harald Scherm UGA Plant Pathology, Athens, GA Dr. Jinru Chen UGA Food Science, Griffin,
More informationAn outbreak of norovirus infection linked to oyster consumption at a UK restaurant, February 2010
Journal of Public Health Advance Access published October 27, 2010 Journal of Public Health pp. 1 7 doi:10.1093/pubmed/fdq089 An outbreak of norovirus infection linked to oyster consumption at a UK restaurant,
More informationE. coli and Coliform Bacteria Levels of Edgewood s Watershed Katie Schneider and Leslie Reed
E. coli and Coliform Bacteria Levels of Edgewood s Watershed Katie Schneider and Leslie Reed Abstract Bacteria levels throughout the Lake Wingra watershed are a concern to the Lake Wingra community. Local
More informationMarketVIEW: Norovirus vaccines (CAT: VAMV015) Background. ****Updated October 2014*** Product Name : MarketVIEW: Norovirus vaccines
****Updated October 2014*** MarketVIEW: Norovirus vaccines (CAT: VAMV015) Product Name : MarketVIEW: Norovirus vaccines Description : Global vaccine commercial opportunity assessment Contents : Executive
More informationOutbreak of Escherichia coli O157. Connecticut, Quyen Phan, MPH Connecticut Department of Public Health
Outbreak of Escherichia coli O157 Associated with Raw Milk, Connecticut, 2008 Quyen Phan, MPH Connecticut Department of Public Health Epidemiology and Emerging Infections Program 2009 OutbreakNet Annual
More informationJonathan Howarth Ph.D and Tina Rodrigues BS Enviro Tech Chemical Services Modesto, CA 95258
The Effectiveness of Water, Sodium Hypochlorite Bleach, and Peroxyacetic Acid (PAA) in Eradicating a Wild Field Strain of E. coli O157:H7 from the Surface of Cucumbers Background Jonathan Howarth Ph.D
More informationUS CDC Vessel Sanitation Program
US CDC Vessel Sanitation Program Background The Centers for Disease Control and Prevention (CDC) established the Vessel Sanitation Program (VSP) in the 1970's as a cooperative activity with the cruise
More informationPr oject Summar y. Survey of the prevalence of Escherichia coli O157:H7 on the surface of subprimal cuts of beef during winter months (Phase I)
Pr oject Summar y Survey of the prevalence of Escherichia coli O157:H7 on the surface of subprimal cuts of beef during winter months (Phase I) Principal Investigators: J. E. (Ken) Kennedy ABC Research
More informationConfirmation Protocol for E. coli O157:H7
Introduction Confirmation Protocol for E. coli O157:H7 The following protocol is used by Hygiena to recover E. coli O157:H7 from beef samples that were enriched according to the BAX System method. The
More informationTufts University Water: Systems, Science, and Society (WSSS) Program
To: From: John Foster, Elbow Cay, the Bahamas; Friends of the Environment, Marsh Harbor, the Bahamas Alex Bedig, Amanda Garfield, Shonda Gaylord, Jack Melcher, Melissa Ng, Nathan Rawding, Kendall Webster,
More informationNorovirus and gut microbiota: friend or foe?
Norovirus and gut microbiota: friend or foe? Kirsty Kwok Supervisor: Dr. Martin Chan MPhil in Microbiology Joint Graduate Seminar, Department of Microbiology, CUHK 5 December 2017 Gut microbiota # gut
More informationSANITATION CONTINUED & KITCHEN SAFETY. Mrs. Anthony
SANITATION CONTINUED & KITCHEN SAFETY Mrs. Anthony POINTS TO REMEMBER: PREVENTING FBI WHEN IN DOUBT, THROW IT OUT. Keep cold foods cold and hot foods hot. Don t handle raw and cooked food at the same time
More informationAddressing challenges associated with the detection of faecal coliform organisms in water matrices. Neil Leat Rand Water Date 30/09/2014
Addressing challenges associated with the detection of faecal coliform organisms in water matrices Neil Leat Rand Water Date 30/09/2014 What are coliforms? Definitions of coliforms are based on biochemical
More informationFind your Local Public Health Agency:
GASTROINTESTINAL ILLNESS IN CHILDREN S RESIDENT CAMPS: OUTBREAK PREVENTION AND CONTROL MEASURES These guidelines are intended for children s residential camp staff and local Environmental Health professionals
More informationMicrobiological quality of water for human consumption in Port-au-Prince after January 2010 earthquake
Water, Innovation, Climate Change and Natural Disasters: Impacts and Prospects for the Bio Bio Region November 15-16, 2010 Concepción, Chile Microbiological quality of water for human consumption in Port-au-Prince
More informationCMX521: THE FIRST NUCLEOSIDE IN CLINICAL DEVELOPMENT FOR NOROVIRUS. Randall Lanier, PhD
CMX521: THE FIRST NUCLEOSIDE IN CLINICAL DEVELOPMENT FOR NOROVIRUS Randall Lanier, PhD Norovirus Infection Is Prevalent and Costly Worldwide: ~700 million cases of norovirus each year (~20 million in U.S.)
More informationLaboratory Line. Perfectly Equipped for Every Challenge. CoreLab DX. Laboratory Equipment
Laboratory Line Perfectly Equipped for Every Challenge > Robust and maintenance-free > Precise and reliable > Easy and safe to handle CoreLab DX Laboratory Equipment Movie Clinical Centrifuges High flexibility
More informationMarler Clark, LLP PS. Since 1993 Marler Clark has represented thousands of legitimate food illness victims in every State.
Marler Clark, LLP PS Since 1993 Marler Clark has represented thousands of legitimate food illness victims in every State. Only a fraction of the victims who contact our office end up being represented.
More informationWIFSS research on E. coli O157:H7 in central coastal California. Rob Atwill, D.V.M., Ph.D. University of California-Davis
WIFSS research on E. coli O157:H7 in central coastal California Rob Atwill, D.V.M., Ph.D. University of California-Davis To all cooperators: ranchers, growers, regulators, environmentalists, resource managers,
More informationProject Summary. Principal Investigators: Lawrence D. Goodridge 1 ; Phil Crandall 2, and Steven Ricke 2. Study Completed 2010
Project Summary Validation of the use of Citrus Essential Oils as a Post Harvest Intervention against Escherichia coli O157:H7 and Salmonella spp. on Beef Carcasses Principal Investigators: Lawrence D.
More informationA Medical Mystery of Epidemic Proportions
STO-116 A Medical Mystery of Epidemic Proportions Daphne s Blog - Sunday I m not sure my decision to be a Peace Corp volunteer was a good idea. I thought I was prepared for working in a village where extreme
More informationConference for Food Protection 2008 Issue Form. Accepted as
Conference for Food Protection 2008 Issue Form Internal Number: 022 Issue: 2008 III-022 Council Recommendation: Accepted as Submitted Accepted as Amended No Action Delegate Action: Accepted Rejected All
More informationInvestigation of the effect of antibiotics on bacterial growth. Introduction. Apparatus. Diagram of Apparatus
Investigation of the effect of antibiotics on bacterial growth Introduction Antimicrobials are agents that are able to kill bacteria or halt their growth. They are widely used in medicine to treat bacterial
More informationPr oject Summar y. Colonization characteristics of bovine recto-anal junction tissues by Escherichia coli O157:H7
Pr oject Summar y Colonization characteristics of bovine recto-anal junction tissues by Escherichia coli O157:H7 Principal Investigators: James L Bono, Terrance M. Arthur, and Tommy L. Wheeler U.S. Department
More informationTOTAL COLIFORM ANDE.coli INDICATOR BACTERIA TEST KIT UV
TOTAL COLIFORM ANDE.coli INDICATOR BACTERIA TEST KIT 4-3616-UV blank WARNING! This set contains chemicals that may be harmful if misused. Read cautions on individual containers carefully. Not to be used
More informationBACTERIAL CONTAMINATION OF WATER WELLS AND SPRINGS
4/15/215 BACTERIAL CONTAMINATION OF WATER WELLS AND SPRINGS Bryan Swistock Water Resources Specialist Penn State Extension Department of Ecosystem Science and Management Microbiological Parameters Standard
More informationTo all our cooperators from across California. be they ranchers, growers, or regulators, activists, resource managers, and the public THANK YOU!
Managing Rangeland sheds for Agricultural Production, Quality, and Food Safety To all our cooperators from across California be they ranchers, growers, or regulators, activists, resource managers, and
More informationBacteriological testing of water
MOBILE NOTE 6 Bacteriological testing of water Introduction Bacteriological water testing is a method of collecting water samples and analysing those samples to estimate the numbers of bacteria present.
More informationIntroduction to Bacteria
Introduction to Bacteria What are bacteria? Single celled organisms Very small Need a microscope to see Can be found on most materials and surfaces Billions on and in your body right now E. Coli O157:H7
More informationGently apply pressure on spreader to distribute over circular area. Do not twist or slide the spreader. Interpretation
0 With flat side down, place spreader on top film over inoculum. Gently apply pressure on spreader to distribute over circular area. Do not twist or slide the spreader. 2 Lift spreader. Wait at least one
More informationSampling for Microbial Analysis
Sampling for Microbial Analysis Linda J. Harris, Ph.D. Department of Food Science and Technology ljharris@ucdavis.edu Microbial Testing One of the most apparent but poorly understood parts of food microbiology
More informationAgri-Food MIG Foodborne Viruses Update. RASFF/ Outbreaks / Recalls
Agri-Food MIG Foodborne Viruses Update RASFF/ Outbreaks / Recalls RASFF reports 2017 Q4-2018 Q1 Date of case Notification from Subject Risk Decision Notification type Action taken 19/01/2018 Italy norovirus
More informationIntroduction to Bacteria
Introduction to Bacteria What are bacteria? Single celled organisms Very small E. Coli O157:H7 can make you very sick. Need a microscope to see Can be found on most materials and surfaces Billions on and
More informationIntroduction to Bacteria
Introduction to Bacteria What are bacteria? Single celled organisms Very small E. Coli O157:H7 can make you very sick. Need a microscope to see Can be found on most materials and surfaces Billions on and
More informationEvaluation of real-time RT-PCR assays for detection and quantification of norovirus genogroups I and II
VIROLOGICA SINICA DOI: 10.1007/s12250-016-3863-9 RESEARCH ARTICLE Evaluation of real-time RT-PCR assays for detection and quantification of norovirus genogroups I and II Kitwadee Rupprom 1, Porntip Chavalitshewinkoon-Petmitr
More informationSterile Technique TEACHER S MANUAL AND STUDENT GUIDE
Sterile Technique TEACHER S MANUAL AND STUDENT GUIDE Table of Contents TEACHER S MANUAL Overview....3 Objectives............................................................. 3 Correlation to Science Standards...3
More informationEscherichia coli. !E. coli
Escherichia coli Escherichia coli!e. coli!gram negative bacteria!non-spore former!rod shape!facultative anaerobic!motile!commonly found in the intestinal tract of humans and animals!some E. coli serotypes
More informationProject Summary. Principal Investigators: Chance Brooks, Mindy Brashears, Mark Miller, Alejandro Echeverry, and Cassandra Chancey
Project Summary The Effect of Lactic Acid and Cooking on the Survivability of E. coli O157:H7 in Needle Tenderized Beef Steaks Managed Under Simulated Industry Conditions Principal Investigators: Chance
More informationThere are 7 kinds of unique dry medium for hygienic testing and detection of food poisoning bacteria.
Simple and Easy Dry Media for Microbial Count and Detection There are 7 kinds of unique dry medium for hygienic testing and detection of food poisoning bacteria. s Small and compact dry media (sterilized)
More informationComparison of Gelman and Millipore Membrane Filters for Enumerating Fecal Coliform Bacteria
APPLIED MICROBIOLOGY, Sept. 1973, p. 332-336 Copyright 0 1973 American Society for Microbiology Vol. 26, No. 3 Printed in U.S.A. Comparison of Gelman and Millipore Membrane Filters for Enumerating Fecal
More informationINTERPRETATION GUIDE AN INTRODUCTION TO USE AND INTERPRETING RESULTS FOR PEEL PLATE CC TESTS. FOR MORE INFORMATION, CONTACT CHARM SCIENCES
INTERPRETATION GUIDE AN INTRODUCTION TO USE AND INTERPRETING RESULTS FOR PEEL PLATE CC TESTS. FOR MORE INFORMATION, CONTACT CHARM SCIENCES INTRODUCTION Peel Plate CC (Coliform Count) tests diffuse the
More informationCalifornia Association for Medical Laboratory Technology
California Association for Medical Laboratory Technology What You Always Wanted to Know About Distance E. coli Learning O157:H7 Infection Program Course # DL-980 by James I. Mangels, MA, CLS, MT(ASCP)
More informationLaboratories & Consulting Group
Final Report Efficacy of Hypobromous Acid as a Hide Intervention Performed July 18-20, 2011 Submitted to Mike Harvey Technical Operations Mgr. Enviro Tech 500 Winmoore Way Modesto, CA 95358 209-232-2211
More information3M TM Petrifilm TM. Petrifilm TM 3M TM. 3M TM Petrifilm TM Serie 2000 Rapid Coliform Count Plates - Ref.: / 50 Unit - Ref.
3M TM Aerobic Count Plates - Ref.: 06400 / 100 Unit - Ref.: 06406 / 1000 Unit 3M TM Enterobacteriaceae Count Plates 3M TM Coliform Count Plates - Ref.: 06420 / 50 Unit - Ref.: 06421 / 1000 Unit - Ref.:
More informationField Situation - How to safely collect oral swabs (saliva) from deceased patients suspected to be infected with Ebola
Field Situation - How to safely collect oral swabs (saliva) from deceased patients suspected to be infected with Ebola Step 1: Before entering patient s room, assemble all equipment Step 1a : Assemble
More informationBSc (Hons) Food Science and Technology (Minor: Food Microbiology) (Full-Time)
BSc (Hons) Food Science and Technology (Minor: Food Microbiology) (Full-Time) 1. Objectives The programme is designed to develop the necessary attitude and competence for the application of scientific
More informationCore practical 13: Isolate an individual species from a mixed culture of bacteria using streak plating
Core practical 13 Teacher sheet Core practical 13: Isolate an individual species from a mixed culture of Objectives To successfully use streak plating techniques to isolate a single species of bacteria
More information1250ul Extra Long Pipet Tips (Sterile, Non-Filtered) in 6 hinged racks $18.50
Pricing for non-listed Denville Scientific items is equal to list price and can be found at www.denvillescientific.com TIPS Catalog # Product We Charge P1096-CP 10ul Extra Long Pipet Tips (Non-Sterile,
More informationMolecular characterization of Italian Soil-borne cereal mosaic virus isolates
11 Parasitica, 2005, 61(1):11-16 Molecular characterization of Italian Soil-borne cereal mosaic virus isolates C. RATTI 1, A. PISI 1, V. VALLEGA 2 & C. RUBIES AUTONELL 1 1 Department of Agroenvironmental
More informationWhat about. The Facts of the Case. Evidence in the case. Separating the Chaff from the Wheat. The Key to Successful Foodborne Illness Litigation
1 Separating the Chaff from the Wheat The Key to Successful Foodborne Illness Litigation What about. Bruce Clark and Patti Waller Marler Clark LLP, PS February 21, 2007 The McDonald s Coffee Case The Facts
More informationBacterial Occurrence in Kitchen Hand Towels
PEER-REVIEWED ARTICLE Food Protection Trends, Vol 34, No. 5, p.312-317 Copyright 2014, International Association for Food Protection 6200 Aurora Ave., Suite 200W, Des Moines, IA 50322-2864 Charles P. Gerba,
More informationKit Information 3. Sample Preparation 4. Procedure 4. Analysis of Results 5. Quality Control 6. Disposal 6. Technical Support 6. Order Information 6
Contents Kit Information 3 Introduction......................................... 3 Kit Contents, Storage, and Testing Conditions..................... 3 Principle...........................................3
More informationInformation on epidemiological situation and control measures regarding Classical Swine Fever in wild boar in Hungary
Information on epidemiological situation and control measures regarding Classical Swine Fever in wild boar in Hungary Animal Health and Animal Welfare Directorate Central Agricultural Office, Hungary 2-3
More informationGas Chromatographic Presumptive Test for Coliform Bacteria in Water
AmPID MICROBIOLOGY, Oct. 1975, P. 584-588 Copyright X) 1975 American Society for Microbiology Vol. 30, No. 4 Printed in U.SA. Gas Chromatographic Presumptive Test for Coliform Bacteria in Water JUDITH
More informationNNIN Nanotechnology Education
NNIN Nanotechnology Education Student Worksheet Water purity and filtration Getting down to the nanoscale Water Filtration and Nanoparticles Dear Team: February 11, 2009 Thank you for your recommendation
More informationBacterial Quality of Crystalline Rock and Glacial Aquifers in New England
Bacterial Quality of Crystalline Rock and Glacial Aquifers in New England By Sarah Flanagan and Charles Culbertson, U.S. Geological Survey 2012 New Hampshire Water and Watershed Conference Plymouth State
More informationM u lt i p l e e x p o s u r e s d u r i n g a n o r o v i r u s o u t b r e a k o n a
Research articles M u lt i p l e e x p o s u r e s d u r i n g a n o r o v i r u s o u t b r e a k o n a r i v e r - c r u i s e s a i l i n g t h r o u g h Eu r o p e, 2006 L Verhoef (linda.verhoef@rivm.nl)
More informationBig SHOT III Hybridization Oven
Big SHOT III Hybridization Oven Models 230402 and 230402-2 Whether you are working with Northern Blots, Southern Blots, Microarrays or another application that requires incubation, you will find the Big
More informationThe Dynamics of Norovirus Outbreak Epidemics: Recent Insights
Int. J. Environ. Res. Public Health 2011, 8, 1141-1149; doi:10.3390/ijerph8041141 Review The Dynamics of Norovirus Outbreak Epidemics: Recent Insights John A. Marshall * and Leesa D. Bruggink International
More informationInterpretation Guide 3M Petrifilm Rapid Coliform Count Plates
3M Petrifilm Interpretation Guide 3M Petrifilm Rapid Coliform Count Plates This guide should familiarize you with results on Petrifilm Rapid Coliform Count (RCC) plates as defined by three of the most
More informationLaboratory Evaluation of the 3-Bowl System Used for Washing-Up Eating Utensils in the Field
Name /weme/17_209 07/28/2006 12:13PM Plate # 0-Composite pg 94 # 1 Wilderness and Environmental Medicine, 17, 94 102 (2006) ORIGINAL RESEARCH Laboratory Evaluation of the 3-Bowl System Used for Washing-Up
More informationAnalysis of Indicator Bacteria in NJ Dead-end Lagoons. Michael Callaghan Gasbarro Mentor: Dr. Kathryn Goddard
Analysis of Indicator Bacteria in NJ Dead-end Lagoons Michael Callaghan Gasbarro Mentor: Dr. Kathryn Goddard Delaware Valley Estuary Summit Session 20: January 28, 2015 Dead-end Canals or Lagoons Popular
More informationTechnological Field Performance of a New Point-of-Use Water Treatment Technology in a Randomized Control Trial in Limpopo, South Africa
Technological Field Performance of a New Point-of-Use Water Treatment Technology in a Randomized Control Trial in Limpopo, South Africa Courtney Hill UNC Water and Health Conference October 218 1 Background
More informationFACILITATOR GUIDE. Case Scenario
FACILITATOR GUIDE Case Scenario A case of EVD on board an aircraft arriving from a country with Ebola Virus Disease transmission, to a non-affected country Developed in association with WHO Collaborating
More informationFecal Coliform Bacteria Monitoring for the Sleepy Creek Watershed Incremental 319 Project Final Report
Fecal Coliform Bacteria Monitoring for the Sleepy Creek Watershed Incremental 319 Project Final Report Prepared for: West Virginia Conservation Agency Prepared by: Cacapon Institute Back Creek Road PO
More informationLunch Ladies to Chefs: Yes We Can!
Lunch Ladies to Chefs: Yes We Can! Adam W. Simmons Child Nutrition Director Fayetteville Public Schools Culinary Skills for Schools How to take your team members from Lunch Ladies to Culinary Professionals
More informationA surveillance study of E. coli O157:H7 and Enterobacteriaceae in Irish retail minced beef and beef burgers
Final Copy Page 1 14/10/2002 A surveillance study of E. coli O157:H7 and Enterobacteriaceae in Irish retail minced beef and beef burgers Background In 1999, the Food Safety Authority of Ireland (FSAI)
More informationPr oject Summar y. Impact of ground beef packaging systems and temperature abuse on the safety of ground beef
Pr oject Summar y Impact of ground beef packaging systems and temperature abuse on the safety of ground beef Principal Investigators: J Chance Brooks, Mindy M. Brashears, Mark F. Miller, and Adam Tittor
More information3M Molecular Detection Assay E. coli O157 (including H7) Performance Summary
3M Food Safety Technical Bulletin Number: TB.171058.02 Effective Date: Feb 15, 2012 Supersedes: TB.171058.01 Technology Platform: Pathogens Originating Location: St. Paul, MN 3M Molecular Detection Assay
More informationSalinas Valley, Monterey County
Irrigation mediated transfer of E. coli O157:H7 from feces to lettuce, 211 & 212 Rob Atwill, Jennifer Chase, M. Jay, L. Harris, R. Bond, M. Partyka, WCFS field & lab crew Western Center for Food Safety,
More informationRapid detection and evolutionary analysis of Legionella pneumophila serogroup 1 ST47
Rapid detection and evolutionary analysis of Legionella pneumophila serogroup 1 ST47 M. Mentasti, P. Cassier, S. David, C. Ginevra, L. Gomez-Valero, A. Underwood, B. Afshar, J. Etienne, Julian Parkhill,
More informationHigh Speed Centrifuge. LHS-A, B Series
High Speed Centrifuge LHS-A, B Series info@labtron.com www.labtron.com High Speed Centrifuge LHS-A10 High Speed Centrifuge LHS-A10 is a microprocessor controlled light weight table top type system with
More informationEffect of food safety systems on the microbiological quality of beef
Effect of food safety systems on the microbiological quality of beef by Papiso Ariette Tshabalala Thesis submitted in partial fulfilment of the requirements for the degree Doctor of Philosophy (PhD) in
More informationWEEKLY EPIDEMIOLOGICAL REPORT WEST NILE VIRUS INFECTION, GREECE, Aug
HELLENIC CENTRE FOR DISEASE CONTROL AND PREVENTION (HCDCP-KEELPNO) MINISTRY OF HEALTH WEEKLY EPIDEMIOLOGICAL REPORT WEST NILE VIRUS INFECTION, GREECE, 2012-31 Aug. 2012 - This weekly epidemiological report
More information